ID: 911503532

View in Genome Browser
Species Human (GRCh38)
Location 1:98719222-98719244
Sequence TATTGCCTGGCCCATAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911503524_911503532 24 Left 911503524 1:98719175-98719197 CCTAGCTCATAGTGCTAAATGTG 0: 1
1: 0
2: 1
3: 5
4: 111
Right 911503532 1:98719222-98719244 TATTGCCTGGCCCATAGGAAGGG 0: 1
1: 0
2: 2
3: 26
4: 183
911503527_911503532 -3 Left 911503527 1:98719202-98719224 CCCATGTAGGGTGCTTAGAATAT 0: 1
1: 0
2: 0
3: 14
4: 111
Right 911503532 1:98719222-98719244 TATTGCCTGGCCCATAGGAAGGG 0: 1
1: 0
2: 2
3: 26
4: 183
911503528_911503532 -4 Left 911503528 1:98719203-98719225 CCATGTAGGGTGCTTAGAATATT 0: 1
1: 0
2: 0
3: 26
4: 169
Right 911503532 1:98719222-98719244 TATTGCCTGGCCCATAGGAAGGG 0: 1
1: 0
2: 2
3: 26
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911503532 Original CRISPR TATTGCCTGGCCCATAGGAA GGG Intronic
902938604 1:19783091-19783113 TGGTGCCTGGCACATAGCAAAGG + Intronic
902994849 1:20216346-20216368 CAGTGCCTGGCACATAGGGAGGG + Intergenic
903307201 1:22421279-22421301 TGATGCCTGTCCCATTGGAAGGG - Intergenic
904323050 1:29709112-29709134 TACTGCCTGGCCCCTGTGAAAGG + Intergenic
906222365 1:44091363-44091385 CAGTGCCTGGCCCAGAGGTATGG - Intergenic
907442331 1:54486861-54486883 TAATTCCTGGCACATAGTAAGGG - Intergenic
908111076 1:60898027-60898049 TAGGGCCTGGCCCATGGGAAAGG - Intronic
908782754 1:67706596-67706618 TATCTCCAGGCCCAGAGGAATGG + Intronic
910186908 1:84552636-84552658 TAATTCCTAGCCCTTAGGAACGG - Exonic
910650706 1:89563467-89563489 TATTGTGTGGCCCATAAGGAAGG - Intronic
910958947 1:92740087-92740109 TATTCCCTGGCTCTAAGGAAGGG - Intronic
911503532 1:98719222-98719244 TATTGCCTGGCCCATAGGAAGGG + Intronic
915250736 1:154586488-154586510 TAGTGCCTGGCGCATAGCAGGGG - Intronic
916356727 1:163917981-163918003 TTTTGAATGGCTCATAGGAAAGG + Intergenic
923401635 1:233620878-233620900 CATTGCCTGGCACATATAAAGGG - Intronic
924073554 1:240308856-240308878 TTTGGCCTGGGCAATAGGAAGGG + Intronic
1063436893 10:6039881-6039903 TGTTGCCTGGCTCATGGGCAGGG - Intronic
1067657901 10:48211177-48211199 CAGTGCCTGGCCCACAGCAAGGG + Intronic
1067720875 10:48726952-48726974 CATGGCCTGTCCCCTAGGAATGG + Intronic
1068766539 10:60770408-60770430 TAGTGCTTGGGGCATAGGAAAGG + Intergenic
1070728093 10:78805820-78805842 AAGTGCCTGGCCCATGGTAAGGG - Intergenic
1071276287 10:84058670-84058692 CAGTGCCTGGCACATAGGGAAGG - Intergenic
1073591765 10:104764679-104764701 CATTGCCTGGTCCATAGTACTGG + Intronic
1074907063 10:117874189-117874211 TATGGCCTGACCCATAGAAAAGG + Intergenic
1075306622 10:121373758-121373780 TAAGGCCTGGCACATAGCAAGGG - Intergenic
1076022453 10:127085272-127085294 TATTGCCTGGCACATACCAGAGG - Intronic
1076677568 10:132155289-132155311 CAGTGCCTGCCACATAGGAAAGG - Intronic
1078180344 11:9005110-9005132 TAGTACCTGGCACATAGTAAAGG - Intergenic
1080601162 11:33821578-33821600 TGTTGCTTGGTTCATAGGAAGGG - Intergenic
1080602494 11:33833553-33833575 TAGTGCCTGGCACATAGTAGGGG + Intergenic
1081572397 11:44299948-44299970 TACTGCCTGGCGCACAGGCAGGG + Intronic
1085258100 11:75188433-75188455 CAATGCCTGGCCCATAGGGAAGG - Intronic
1085291873 11:75406548-75406570 TATTGCTTGGCACATGGTAAGGG + Intronic
1085729788 11:78987015-78987037 TAATGTCTGGCCCACAGGAAAGG + Intronic
1086566797 11:88236466-88236488 CAGTGCCTGGCACATAGTAAGGG - Intergenic
1087533374 11:99411956-99411978 TCTTGTCTGGCCCATAGTTAAGG - Intronic
1089474655 11:118749056-118749078 TTTTGCCTCTCCCATAGGAATGG - Exonic
1090954910 11:131505145-131505167 TATTACCTGTCCCACAGGAGTGG + Intronic
1091232554 11:133998187-133998209 AACTGCCTGGCCCATAGCAGGGG + Intergenic
1094106969 12:26823525-26823547 TATTGCCCGGCACACAGAAAGGG + Intronic
1094243442 12:28257447-28257469 TTTGGACTTGCCCATAGGAATGG + Intronic
1096807874 12:54151368-54151390 TACTACCTGGCCCAGAGGAAGGG + Intergenic
1097700074 12:62810909-62810931 TGGAGCCTGGCACATAGGAAAGG - Intronic
1097746286 12:63307125-63307147 TGATGCCTGGCACATAGGAGAGG - Intergenic
1101126310 12:101638297-101638319 CAGTGCCTGGCACATAGAAAAGG + Intronic
1101542539 12:105677906-105677928 TATGTCCTGGCACTTAGGAAAGG - Intergenic
1102150560 12:110687114-110687136 CAGTGCCTGGCACCTAGGAATGG - Intronic
1102349250 12:112180022-112180044 TCATGACTGGCCCTTAGGAAAGG - Intronic
1102569679 12:113819808-113819830 ATTTGCCTGGCCCAGAGGAGGGG - Intronic
1103854959 12:123960924-123960946 GATTGCCTGGCCTATTGTAAAGG - Intronic
1104739817 12:131164367-131164389 TGTTCCCTGGCCAATGGGAAAGG - Intergenic
1104792670 12:131493606-131493628 TGTTCCCTGGCCAATGGGAAAGG + Intergenic
1106805358 13:33301173-33301195 CAGTGCCTGGTACATAGGAATGG + Intronic
1107166809 13:37291915-37291937 CATTGCCTGGCCCATAGTAAGGG - Intergenic
1107653668 13:42570292-42570314 AATTCCCTGGCTCAAAGGAAAGG + Intronic
1107967611 13:45611831-45611853 TAGTGCCTGGCACATGGAAATGG - Intronic
1108479449 13:50853666-50853688 TGTTGACTGGCTCTTAGGAAAGG - Intergenic
1110144730 13:72176951-72176973 CAGTGCCTGGGCCACAGGAAAGG - Intergenic
1110194817 13:72776603-72776625 TAGTGCCTGGCACATAGGTATGG - Intronic
1110240474 13:73260954-73260976 TAGTGCCTGACCCAGAGGGAGGG - Intergenic
1115314882 14:32015101-32015123 TATTGCTTGGCCTATAGGACTGG + Intronic
1117528185 14:56632450-56632472 TGTTGCCTGGCACCTGGGAAAGG + Intronic
1117694701 14:58348368-58348390 TAGTGCCTGGCACATAATAAAGG + Intronic
1118118152 14:62804799-62804821 TTTAGCCTGGCACATAGCAAGGG + Intronic
1119294673 14:73523181-73523203 CACTGCCTGGCCTAGAGGAAAGG + Exonic
1119415352 14:74465999-74466021 TACTGCCAGTCTCATAGGAACGG + Intergenic
1125261097 15:37825378-37825400 ATTTGCCTGGCCCAGAGGCATGG + Intergenic
1127968006 15:63938365-63938387 TAGTGCCTGGCACACAGCAAGGG + Intronic
1129910989 15:79226166-79226188 GTGTGCCTGGCCCATAGGAAGGG + Intergenic
1130074842 15:80679745-80679767 TACTGCCTGGCACAGAGGTAGGG + Intronic
1134541223 16:15067466-15067488 AACTGCCTGGCACAGAGGAAAGG + Intronic
1135436681 16:22432021-22432043 AACTGCCTGGCACAGAGGAAAGG + Intronic
1135814751 16:25622412-25622434 TATTGCCTGGCCCATACTAGGGG + Intergenic
1135825071 16:25719940-25719962 TAGTGTCTGGCCCATAGTAAAGG + Intronic
1136263577 16:29099896-29099918 AACTGCCTGGCACAGAGGAAAGG - Intergenic
1137482881 16:48866960-48866982 GATTGCCTGACCCAGAGAAAAGG + Intergenic
1137975135 16:53024836-53024858 TAGTGCCTGACACATATGAAGGG - Intergenic
1140780513 16:78292258-78292280 TAAGGCGTGGCCCATAGTAAGGG + Intronic
1141086409 16:81098626-81098648 TAGTGCCAGGCACATAGCAAAGG - Intergenic
1141422187 16:83924512-83924534 CATCGCCTGGCACATAGGAGAGG + Exonic
1142135899 16:88451956-88451978 TATTCCCTGGCTCCAAGGAAGGG - Intergenic
1144061880 17:11590319-11590341 TAATGCATGGCACATAAGAAAGG + Intergenic
1145772149 17:27500995-27501017 CAATGCCTGGTACATAGGAAGGG - Intronic
1146460509 17:33042507-33042529 CAGTGCCTGGCACATAGTAAAGG - Intronic
1147721361 17:42541521-42541543 TAACGCCTGGCCCAGAGCAAAGG + Intronic
1149576882 17:57720169-57720191 TAATGTCTGGCCCATAGACATGG - Intergenic
1151331278 17:73410685-73410707 TACTGCCTGGCCCAGAGAAAGGG + Intronic
1152361772 17:79836199-79836221 TAGTGCCTGGCCTTTAAGAAAGG - Intronic
1153656223 18:7284864-7284886 TATGGCCTGGCACATAGGGGAGG + Intergenic
1155411524 18:25550719-25550741 TACTTGCTGGGCCATAGGAAAGG + Intergenic
1160284782 18:77531425-77531447 TATTGTCTTGCCCAGAGGTAAGG - Intergenic
1162917638 19:13882837-13882859 TATTCCCAGGCCCCTTGGAAGGG + Exonic
1163165394 19:15494142-15494164 TCTTGCCTTTCCCATATGAATGG - Intronic
1163425407 19:17238182-17238204 TAATGCCTGCCACACAGGAAAGG + Intronic
1163769026 19:19179606-19179628 CAGTGCCTGGCCAATAGGCAGGG + Intronic
1165017159 19:32889661-32889683 TACTCCCTGGCCCATGGGAGAGG + Intronic
1166909650 19:46143712-46143734 TAGTGCCTGGCAAATGGGAAGGG - Intronic
1167196220 19:48030651-48030673 CAGTGCCTGCCACATAGGAAGGG - Intronic
926772067 2:16387158-16387180 CCTTGCCTGGCCACTAGGAAAGG - Intergenic
928592994 2:32836252-32836274 TAGTGCCTGACACATGGGAAAGG - Intergenic
929590406 2:43142151-43142173 CATTGCCTGGCATATAGAAAAGG + Intergenic
933190277 2:79326547-79326569 TCTTTCTTGGGCCATAGGAATGG + Intronic
934626491 2:95861017-95861039 TTTGGCCTGGCTCATGGGAATGG - Intronic
934807067 2:97240278-97240300 TTTGGCCTGGCTCATGGGAATGG + Intronic
934830439 2:97516897-97516919 TTTGGCCTGGCTCATGGGAATGG - Intronic
938979765 2:136515011-136515033 TATTGCTAGGCTAATAGGAAAGG + Intergenic
943847817 2:192674332-192674354 TATTGACTGGCCACTAGGACGGG + Intergenic
944337678 2:198556456-198556478 TATTGCCTGGCACATATTAAGGG - Intronic
946343692 2:219090406-219090428 TAGTGCCTGGCACATAGGAAGGG + Intronic
947010914 2:225565674-225565696 TACTGCCTGGGATATAGGAAGGG - Intronic
947344938 2:229180845-229180867 CATTGCCTGTCCCTTCGGAACGG + Intronic
1169202468 20:3718796-3718818 TACTGCCAGGCCCACAGTAACGG - Intergenic
1169207205 20:3747269-3747291 TCATGCCTGGCCCATAGGTATGG - Intronic
1172510624 20:35498425-35498447 TAGTGCCTGGCCCATACTTATGG + Intronic
1174474982 20:50790261-50790283 CAGTGCCTGGCACATAGTAAGGG + Intergenic
1176954543 21:15086127-15086149 TATTGCCTATCACATGGGAATGG + Intergenic
1179190286 21:39117293-39117315 TAACGCGTGGCCCAGAGGAAGGG + Intergenic
1179396224 21:41042896-41042918 CAGTGCCTGGCATATAGGAAAGG - Intergenic
1181856522 22:25785205-25785227 GATTTCCTGGCCTTTAGGAAGGG + Intronic
1182300068 22:29332179-29332201 CAGTGCCTGGCCCAGAGGAGAGG - Intronic
1182772959 22:32809090-32809112 CAGTGCCTGGCACATAGTAAGGG - Intronic
1182909167 22:33966320-33966342 CATTATCTGGCCCAAAGGAAAGG - Intergenic
1182920511 22:34074985-34075007 CACAGCCTGGCCCATAGTAAGGG - Intergenic
1183855992 22:40635701-40635723 CAGTGCTTGGCCCATAGTAAGGG - Intronic
1185036892 22:48484072-48484094 TAGTGCCTGGCCCTTAGTATGGG + Intergenic
951509796 3:23487560-23487582 CAGTGCCTGGCTCATAGTAATGG - Intronic
954926993 3:54244546-54244568 TAATGCCTGGCTCATAGGTAAGG + Intronic
955025602 3:55164470-55164492 TACTGGCTGGCCTTTAGGAATGG + Intergenic
957568205 3:81911370-81911392 TACTGCCAAGACCATAGGAAAGG + Intergenic
958984033 3:100759625-100759647 TATTGCTTGGCATTTAGGAAGGG - Intronic
960242836 3:115365833-115365855 TATTGCCTGGGCAACATGAAGGG + Intergenic
962179449 3:133190440-133190462 TATTGCCAGGCCCCCAGAAATGG + Intronic
962381521 3:134901925-134901947 CAGTGACTGGCCAATAGGAAAGG + Intronic
963722135 3:148873851-148873873 AAGTGCCTGGCACATAAGAAAGG + Intronic
964092824 3:152896076-152896098 TACCGCCTGGCTCAGAGGAAGGG - Intergenic
968570086 4:1334721-1334743 TCTTGCCTGACCCATGGCAACGG - Intronic
968610063 4:1552806-1552828 AACTGCCTGGCCCGAAGGAAGGG + Intergenic
972786081 4:42327800-42327822 AACTGCTTGGCCCATAGAAAAGG + Intergenic
973154954 4:46939363-46939385 TAGTGCCTGGCCCATATTAAGGG - Intronic
973634098 4:52846013-52846035 TATTGCCTGGCACATAGTAGGGG + Intergenic
974653431 4:64785848-64785870 TATTGACTGGACCTTAGGGAAGG - Intergenic
974724827 4:65785078-65785100 AATTGCATGGCACATAGGAATGG + Intergenic
975574471 4:75849020-75849042 TATTTCCTGGAACATAGGGATGG + Intergenic
976204118 4:82608485-82608507 TAGTACCTGGCACATAGTAAGGG - Intergenic
976224502 4:82784859-82784881 TATTGCCTGGCCCAGCTGCAGGG - Intronic
977924864 4:102688506-102688528 TGTTGTCTGGCCCACAGGAGAGG + Intronic
979108591 4:116720155-116720177 TATTTCCTGGCCCCTAGAGAAGG + Intergenic
979376767 4:119955411-119955433 TATTTCCTGGCTGATAGCAAAGG + Intergenic
979543862 4:121917466-121917488 TACTGCCTGGATCATAGGAGGGG - Intronic
983684701 4:170394635-170394657 AAGTGCTTGTCCCATAGGAAAGG + Intergenic
984773717 4:183461712-183461734 TATGGTCTGGCCTATAGGTATGG + Intergenic
986258007 5:6117267-6117289 TAGCGTCTGGCCCAGAGGAAAGG + Intergenic
989499128 5:42145574-42145596 TATTGCATGGCTCATAGCAATGG + Intergenic
991945286 5:71893402-71893424 CATTGCCTGGCCCACAGTGAGGG - Intergenic
992019861 5:72611941-72611963 AAATGGCTGGCCCATAGGAAAGG + Intergenic
992202321 5:74396510-74396532 AATTACCTGGCACATAGTAAGGG + Intergenic
993318619 5:86443530-86443552 TAATGTCTGGCACATAGTAAGGG + Intergenic
993751998 5:91681542-91681564 TTTTGGCTGGCCGATAGGATTGG + Intergenic
994988860 5:106972733-106972755 TAGTGCCTAGTCCATAGTAAGGG - Intergenic
995007570 5:107218684-107218706 CAATGTCTGGCACATAGGAAGGG - Intergenic
996470787 5:123857756-123857778 TAGTGCCTGGCACAGAGGAGAGG + Intergenic
998357824 5:141555994-141556016 TATTCCCTTGCCCAAGGGAAGGG - Intronic
999280815 5:150364404-150364426 TAATGCCTGGCACGGAGGAAGGG - Intronic
999551717 5:152694843-152694865 TTTTGCCTGGACTATTGGAATGG + Intergenic
999618286 5:153448837-153448859 TAATGCCTGGCACATAGTTAGGG + Intergenic
999767359 5:154751363-154751385 TAGTGCCTGGCACATAGTAGGGG + Intronic
1000290266 5:159863605-159863627 TAGTGCCTGGCACATAGTAAAGG - Intergenic
1003623301 6:7721175-7721197 CACTGCCTGGCACATAGGCATGG + Intergenic
1003732032 6:8836039-8836061 TACTACCTGGCTCATAGTAAAGG - Intergenic
1004284571 6:14308809-14308831 TAATGCCTGGCACATAGTAGAGG + Intergenic
1005439451 6:25850126-25850148 TGTTGCCTGGGTCATAGGCATGG - Exonic
1005460424 6:26064320-26064342 TAATGCCTGGTGCAGAGGAAGGG - Intergenic
1005642878 6:27813734-27813756 TATTTCCTGGCCTCTAGGAAAGG - Intergenic
1006559530 6:34898069-34898091 TAATGCCTGGCACATGGCAAGGG + Intronic
1007172422 6:39873133-39873155 TATGCCCTGTCTCATAGGAAAGG - Intronic
1009987322 6:70796216-70796238 CAGTGCCTGGCACATAGTAACGG + Intronic
1013903695 6:115188785-115188807 TTTTTCCTGGCCCACAGGACTGG - Intergenic
1016575270 6:145563224-145563246 TATTGGCTTGCCCAGAGGAGTGG + Intronic
1017912489 6:158806024-158806046 TTTTGGGGGGCCCATAGGAATGG - Intronic
1027551834 7:79607923-79607945 AATGGCCTGGCACATAGCAATGG - Intergenic
1031105971 7:117543488-117543510 TAGTGCCTGGCACATAGTAAGGG - Intronic
1032074165 7:128828529-128828551 AATTGCCTGGTCCTTAGGTAGGG - Intergenic
1032986134 7:137339537-137339559 TGTTGCCTGACCCTTAGGCAGGG + Intronic
1033648844 7:143324618-143324640 CATTGCCTGGCACATAGCAAAGG - Intronic
1038154703 8:24978133-24978155 TTTTGACTGGCAAATAGGAAAGG + Intergenic
1038346205 8:26734849-26734871 CAATGCCTGGCACATAGCAAGGG - Intergenic
1040780722 8:51106315-51106337 CAATGCCTGACACATAGGAAGGG - Intergenic
1041627129 8:60043204-60043226 TCTTTCCTGTCCCATAGGCATGG + Intergenic
1042003576 8:64155134-64155156 TATTGCCTGACCCATAGGTGGGG - Intergenic
1042026121 8:64425749-64425771 TTCTATCTGGCCCATAGGAATGG - Intergenic
1042758560 8:72245675-72245697 GAGTGCCTGGCCTGTAGGAATGG + Intergenic
1046448275 8:114354225-114354247 TAATTCCTAGCCCATAGGTATGG - Intergenic
1046507482 8:115154710-115154732 AATTTCCTGTCCCAAAGGAAGGG - Intergenic
1047066833 8:121293503-121293525 TATTACCTAGCTCATAGGACTGG - Intergenic
1051630449 9:19135794-19135816 TAATGCCAGGCACATAGAAATGG + Intronic
1055630911 9:78222325-78222347 TACTGCCTGGCCCAGAAGAGGGG + Intergenic
1059008976 9:110435774-110435796 TATTATTTGGCCCATAGTAAAGG - Intronic
1059419953 9:114184647-114184669 CAGTGCCTGGCACACAGGAAGGG - Intronic
1059960493 9:119559849-119559871 TGCTGCCTGGCCCAAAGGCAGGG - Intergenic
1061390179 9:130313296-130313318 TAGTGTCTGGGGCATAGGAAGGG + Intronic
1203582960 Un_KI270746v1:30319-30341 TTTGGCCTGGCTCATGGGAATGG + Intergenic
1188223817 X:27572691-27572713 TATTCACTGACCCATATGAATGG - Intergenic
1188671254 X:32884421-32884443 AAGTGCCTGGCCCATAGTAAGGG - Intronic
1190775005 X:53545619-53545641 CAGTGCCTGGCCCATAGGTGTGG + Intronic
1195160388 X:102165003-102165025 TATTGCCTTGCCCAGAAGTAAGG - Intergenic
1195383939 X:104296078-104296100 CAGGGCCTGGCCTATAGGAAGGG + Intergenic
1195700572 X:107702542-107702564 TGGTGCCTGGCACATAGGATAGG + Intergenic
1196865901 X:120070688-120070710 TATTGCTTGTCACATAGTAAAGG + Intergenic
1196877195 X:120165592-120165614 TATTGCTTGTCACATAGTAAAGG - Intergenic
1197146898 X:123181920-123181942 TAGTGCCTGGCACAGAGTAAAGG + Intergenic
1197271443 X:124428680-124428702 CAGTGCCTGGCACATAGTAAGGG + Intronic
1198677925 X:139150651-139150673 CAGTGCCTGGCACATAGAAAGGG - Intronic