ID: 911505239

View in Genome Browser
Species Human (GRCh38)
Location 1:98740987-98741009
Sequence TTGGAGCCCTTAAATGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911505236_911505239 -1 Left 911505236 1:98740965-98740987 CCAGTAAAACAAAATCAAGAAGT 0: 1
1: 0
2: 5
3: 33
4: 509
Right 911505239 1:98740987-98741009 TTGGAGCCCTTAAATGATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911505239 Original CRISPR TTGGAGCCCTTAAATGATCA GGG Intronic
901926694 1:12570748-12570770 TAGGAGCCCCTAGTTGATCAGGG - Intronic
905319360 1:37105006-37105028 TTGGGGCCCTTTGATGCTCAGGG + Intergenic
905635468 1:39548447-39548469 GAGGAGCCCTTAAATTATCCTGG + Intergenic
906696830 1:47828786-47828808 GTGGAGCCCTTAAAAGATCAGGG + Intronic
906728520 1:48061602-48061624 CTGGAGCCCTGAAATCACCATGG + Intergenic
909608106 1:77526822-77526844 TTGAAACCCTCAAATGATCGAGG + Intronic
911505239 1:98740987-98741009 TTGGAGCCCTTAAATGATCAGGG + Intronic
911746719 1:101448996-101449018 TTGGGGCCCTTTAATGTTGAGGG + Intergenic
916355158 1:163897729-163897751 TTGGAGTCATTAAATCTTCAAGG + Intergenic
918489018 1:185060456-185060478 TTTGAGTCCTTAAGTGAGCAAGG - Intronic
924029183 1:239869296-239869318 CTTGAGCCCTAAAATGATGAAGG + Intronic
1065965098 10:30764404-30764426 TTCAGGCCCGTAAATGATCAGGG + Intergenic
1071212996 10:83366172-83366194 TTGGAACCCTAACATGAACAGGG + Intergenic
1073523295 10:104155263-104155285 TTGTTGCCCTTGGATGATCAAGG - Intronic
1078042949 11:7884881-7884903 GTGGAGCAGGTAAATGATCAAGG + Intergenic
1082153116 11:48767184-48767206 TTGGAGCCCTTCAAGGACTATGG - Intergenic
1082153369 11:48771464-48771486 TTGGAGCCCTTTGAGGACCATGG - Intergenic
1083385082 11:62302034-62302056 GTGGAGCCCTTGAAGGAACAGGG - Intergenic
1084870012 11:72092075-72092097 TTAGAGAAGTTAAATGATCAGGG - Intronic
1085324806 11:75598373-75598395 TAGGAGCCCTGAACTGAGCAGGG + Intronic
1089838198 11:121390626-121390648 TTGAAGCCATTAAAGGATTAAGG - Intergenic
1095501800 12:42847857-42847879 TTGGAGCCCTTTAATTCTTAAGG + Intergenic
1097945921 12:65367281-65367303 CTGGAGCACTTATATGATGAAGG + Intronic
1099679655 12:85809345-85809367 TTAGAGCACTCAAATGATCGAGG + Intronic
1100698560 12:97121507-97121529 TTGTGGCCCATAAATGGTCATGG - Intergenic
1105463425 13:20613459-20613481 TTGGAACTCTTAAATGCTGATGG + Intronic
1107518079 13:41151171-41151193 TTGGAGCCCTTTAATGAATAGGG - Intergenic
1110527402 13:76554968-76554990 TTTGAGCCCTTCTATGGTCAAGG - Intergenic
1111102100 13:83601799-83601821 TTGGAGTCATTGATTGATCAGGG - Intergenic
1117969546 14:61238479-61238501 TTGGAGCCCTTTAATGTTGCAGG + Intronic
1119290791 14:73493176-73493198 TTGGTGCTCTGAAATGATCACGG - Exonic
1120085437 14:80267116-80267138 TTGGAGCCCTTTAGTCAGCAGGG - Intronic
1120490766 14:85176086-85176108 TTGAAGCCCTTAAATGGCCAAGG + Intergenic
1122031688 14:98916911-98916933 TTGGAACACTTAAAAGAGCAGGG - Intergenic
1126791585 15:52226501-52226523 CTGGAGCCCTTAAATACTCAGGG - Intronic
1130444025 15:83981905-83981927 ATGGAGCCATTATATGAGCATGG + Intronic
1132292156 15:100711324-100711346 TTGGATCCCTTGACTGATCTTGG + Intergenic
1140907607 16:79422465-79422487 TTGGAGGCAGTAAATGGTCAAGG - Intergenic
1140974510 16:80045845-80045867 GTGGAGACCTTAAATGAACTGGG - Intergenic
1143085182 17:4410785-4410807 TTGTACACCTTAAATGAACATGG + Intergenic
1150349157 17:64429295-64429317 TTGGAGCCCTTTGAGGAACAGGG + Intergenic
1154926077 18:20936354-20936376 TTGGAGCCCTTTAATGATTTTGG + Intergenic
1157123303 18:44932773-44932795 GAGGAGTCCTTAAATGACCATGG - Intronic
1157628401 18:49071670-49071692 TTGGGGGCCTAAAATAATCAGGG + Intronic
1160670220 19:358798-358820 TGGGTCGCCTTAAATGATCAAGG + Intergenic
1161334319 19:3704226-3704248 CTGGAGCCTTAAAATGGTCAAGG - Intergenic
1164235327 19:23327006-23327028 TTGGAGCTCTGAAATGATCTGGG - Intronic
1164301447 19:23965577-23965599 TTGGAGCTCTGAAATGTTCTGGG + Intergenic
1164322926 19:24166920-24166942 TTGCAGCCCTTAATTGATGGTGG + Intergenic
1165544898 19:36527200-36527222 TAGGAGTACTTAGATGATCAAGG + Intronic
1166272985 19:41728854-41728876 GTGGAGCCCATTAATGAACAGGG - Intronic
1166414281 19:42582005-42582027 GTGGAGCCCATTAATGAACAGGG + Intronic
928789744 2:34936052-34936074 TTGGGGCACTCAAATGACCATGG + Intergenic
934699307 2:96426904-96426926 TTGGTACTCTTAAATAATCAAGG - Intergenic
935021558 2:99237343-99237365 TTGGAACCCTTTAATGTTGAGGG - Intronic
939262454 2:139828288-139828310 TTGCAGCCCCTAGATGCTCAAGG + Intergenic
941461340 2:165775505-165775527 TTGGAATCTTTAAGTGATCAGGG - Intronic
942644330 2:178094637-178094659 TTTGAGCCCTTAATTCATAAAGG - Intronic
946362258 2:219226082-219226104 TTGGAGCGTTGAGATGATCAAGG + Intronic
1170486707 20:16824635-16824657 TTGCATCCCAGAAATGATCATGG - Intergenic
1176991552 21:15503310-15503332 TGGCAGCCCTCAAATGCTCAAGG + Intergenic
1181748205 22:24970547-24970569 TAGGAGCCTTTACATGATAAAGG - Intronic
1183174755 22:36214752-36214774 GTGGAGCCCTTTAAGGAACAGGG + Intergenic
1183510725 22:38233188-38233210 TGGGAGCCCTTAATGGATTAGGG - Intronic
1183642071 22:39098776-39098798 TTGGAGGCTTGAAATGCTCAGGG + Intronic
952123934 3:30277030-30277052 TTGGAGCCCTTGGAAGAACAGGG - Intergenic
953273750 3:41474031-41474053 ATGGAGCCCTCAAATGGCCAAGG + Intronic
953352894 3:42229526-42229548 TTGGAGCCCCAAACTCATCAGGG - Intergenic
953720773 3:45353010-45353032 ATGAAGACCTTCAATGATCAGGG + Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955906472 3:63813106-63813128 TTGGAGCCATTAAAAGAAGAAGG - Intergenic
956608278 3:71095383-71095405 TTGGGGCCATTAATTGATGAAGG - Intronic
960880993 3:122344654-122344676 GTGGGGCCCTTAAAAGATGATGG - Intergenic
961739838 3:129026334-129026356 TTGAAACCCTTAAATGATTTAGG + Intronic
962119115 3:132543418-132543440 TGTCAGCCCTAAAATGATCAAGG + Intergenic
963251417 3:143106685-143106707 GTGGAGCCCTTAAACAAACAGGG - Intergenic
964453414 3:156835351-156835373 GTGGAGCCCTTCAAGGAACAGGG + Intronic
965278804 3:166722291-166722313 ATGGAGCCCTTCAATAAACAGGG + Intergenic
969420067 4:7088876-7088898 GTGGAGCCCTTAGAAGAACAGGG + Intergenic
971525051 4:27606193-27606215 TCAGAGCTCTTAAGTGATCAGGG - Intergenic
971782485 4:31054701-31054723 TTGGTGCCATTATATGATAAAGG + Intronic
973082951 4:46017295-46017317 ATGAAGCCCTTAATTGCTCATGG - Intergenic
973527824 4:51796585-51796607 TTGGAGCGCTTAGAGGCTCATGG - Intergenic
973527962 4:51798796-51798818 TTGGAGCGCTTAGAGGCTCATGG - Intergenic
973528099 4:51801007-51801029 TTGGAGCGCTTAGAGGCTCATGG - Intergenic
973528230 4:51803217-51803239 TTGGAGCGCTTAGAGGCTCATGG - Intergenic
973528364 4:51805427-51805449 TTGGAGCGCTTAGAGGCTCATGG - Intergenic
973528495 4:51807636-51807658 TTGGAGCGCTTAGAGGCTCATGG - Intergenic
973528630 4:51809846-51809868 TTGGAGCGCTTAGAGGCTCATGG - Intergenic
973528721 4:51811379-51811401 TTGGAGCGCTTAGAGGCTCATGG - Intergenic
973528910 4:51814434-51814456 TTGGAGCGCTTAGAGGCTCATGG - Intergenic
973529025 4:51816973-51816995 TTGGAGCGCTTAGAGGCTCATGG - Intergenic
973616979 4:52688521-52688543 GTGGAGCCCTTTAATGAACAAGG - Intergenic
978835879 4:113149150-113149172 TTGCAGCCCTGAAGTGAACAAGG + Intronic
979104336 4:116664986-116665008 GTGGAGCCCTTTAAGGAACAGGG - Intergenic
979591524 4:122486322-122486344 GTGGAGCCCTTCAAGGAACAGGG + Intergenic
982376224 4:154693779-154693801 ATGGAGCCAGTAAAAGATCAGGG - Intronic
984856091 4:184197489-184197511 TGGCATCCCTTAGATGATCAGGG - Intronic
992722434 5:79573977-79573999 GTGGAGCCCTTTAATGAATAGGG + Intergenic
993440282 5:87948604-87948626 TTGGGGTCATTAAATGAGCAAGG - Intergenic
994244579 5:97465761-97465783 CTGGAGCCCTTCAAGAATCAAGG + Intergenic
994813180 5:104548807-104548829 TTGGATCCCTTAAACTATCTGGG + Intergenic
995328353 5:110918014-110918036 TTGAAGGCATTAAATGACCAGGG + Intergenic
995652113 5:114381472-114381494 TTAGAGCCCTTAGATTCTCATGG - Intronic
1003553161 6:7116926-7116948 TTGGAGCTCTGAAATGATTTTGG - Intronic
1004884322 6:20037041-20037063 TTGGAGCCATGCATTGATCAAGG + Intergenic
1006196917 6:32249517-32249539 GTGGAGCCCTTTAAGGAACAGGG - Intergenic
1007111711 6:39316658-39316680 TTGGCTCCCTTGAATGACCAAGG + Intronic
1008979011 6:57461944-57461966 TTGGAGTGCTTAAATAATAAAGG - Intronic
1015903391 6:138090633-138090655 TTGGACACCTAAAATGAGCAAGG + Exonic
1018257327 6:161934610-161934632 TTTTTGCCCTTAAATAATCAAGG - Intronic
1018682867 6:166278512-166278534 TTGGAGCCCTTATATGTTGCTGG - Intergenic
1039180913 8:34864959-34864981 TTGGAGACCTTGAAGGATGAAGG - Intergenic
1040127440 8:43754092-43754114 TTGGAGCCATTAATTCAGCAGGG + Intergenic
1044439510 8:92207417-92207439 GTGGAGCCCTTAGAGGAACAGGG + Intergenic
1047433749 8:124817020-124817042 ATGTATCCCTTAAATGATGAGGG + Intergenic
1049124648 8:140775730-140775752 TTGGAGCCCTTTAATGAACTGGG - Intronic
1203416972 Un_KI270334v1:138-160 TTGGAGCGCTTAGAGGCTCATGG + Intergenic
1203417232 Un_KI270338v1:114-136 TTGGAGCGCTTAGAGGCTCATGG + Intergenic
1203417394 Un_KI270340v1:1250-1272 TTGGAGCGCTTAGAGGCTCATGG + Intergenic
1186908601 X:14137653-14137675 CTGGAGCACTTACATGAACATGG + Intergenic
1188575460 X:31644650-31644672 TTCAAGCCCTTAATTGATAATGG - Intronic
1189518220 X:41737470-41737492 TTGGAGCCCTAAAAGTATTATGG - Intronic
1192113176 X:68385923-68385945 TTGGAGCCAATAAAAGAACATGG + Intronic
1192765441 X:74134884-74134906 GTGGAGCCCTTGGATGAACAGGG - Intergenic
1194828245 X:98590417-98590439 GTGGAGCCCTTCAAGGAACAGGG + Intergenic
1196593669 X:117518491-117518513 ATGGTGCCTTTAAATCATCATGG - Intergenic
1199838780 X:151622266-151622288 TTGGAGCCATTAAAATATCTGGG + Intronic
1200812292 Y:7498777-7498799 ATGGGGTCCTTAAGTGATCATGG + Intergenic
1201063943 Y:10071189-10071211 TTGGAGCTCTTAAATGCCTAAGG + Intergenic