ID: 911505712

View in Genome Browser
Species Human (GRCh38)
Location 1:98748097-98748119
Sequence CTCCTAAGTAACCAAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 2, 2: 13, 3: 32, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911505705_911505712 16 Left 911505705 1:98748058-98748080 CCTCTGCCTCCCAGGTTCAAGCG 0: 8736
1: 41830
2: 89454
3: 127546
4: 125241
Right 911505712 1:98748097-98748119 CTCCTAAGTAACCAAGTAGCTGG 0: 1
1: 2
2: 13
3: 32
4: 207
911505708_911505712 6 Left 911505708 1:98748068-98748090 CCAGGTTCAAGCGATTCTCCTGC 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144
Right 911505712 1:98748097-98748119 CTCCTAAGTAACCAAGTAGCTGG 0: 1
1: 2
2: 13
3: 32
4: 207
911505706_911505712 10 Left 911505706 1:98748064-98748086 CCTCCCAGGTTCAAGCGATTCTC 0: 23056
1: 86015
2: 148378
3: 189355
4: 137836
Right 911505712 1:98748097-98748119 CTCCTAAGTAACCAAGTAGCTGG 0: 1
1: 2
2: 13
3: 32
4: 207
911505707_911505712 7 Left 911505707 1:98748067-98748089 CCCAGGTTCAAGCGATTCTCCTG 0: 22579
1: 106059
2: 182600
3: 191733
4: 130765
Right 911505712 1:98748097-98748119 CTCCTAAGTAACCAAGTAGCTGG 0: 1
1: 2
2: 13
3: 32
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911505712 Original CRISPR CTCCTAAGTAACCAAGTAGC TGG Intronic
902253649 1:15172871-15172893 CTCCTAAGTGACCAATGAGCAGG - Intronic
903982805 1:27201968-27201990 CTCCTGAGTAGCTGAGTAGCAGG + Intergenic
904907043 1:33905361-33905383 CTCCTATGAAACCATGTAGCTGG - Intronic
906521969 1:46472555-46472577 CTTCTAAGTAGCCAAATAGAAGG + Intergenic
909022973 1:70452654-70452676 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
909659242 1:78063767-78063789 CTCCTGAGTAGCTGAGTAGCTGG - Intronic
910054934 1:83022441-83022463 CTCCCAAGTACCACAGTAGCTGG + Intergenic
910254460 1:85234012-85234034 CACCTAAGCATCCGAGTAGCTGG + Intergenic
911505712 1:98748097-98748119 CTCCTAAGTAACCAAGTAGCTGG + Intronic
911646325 1:100341076-100341098 TTCCTGAATGACCAAGTAGCAGG + Intergenic
912794066 1:112680283-112680305 CTCCTAATCAAGCAAGTAGTTGG + Intronic
913368208 1:118066670-118066692 CACCTAAGTAACTAAGTAACTGG + Intronic
914251181 1:145923042-145923064 CTCCCGAGTTCCCAAGTAGCTGG + Intergenic
914329916 1:146658180-146658202 CACCTCAGCCACCAAGTAGCTGG + Intergenic
915434369 1:155892418-155892440 CTCCCAAGTAGCTGAGTAGCTGG + Intergenic
917315298 1:173718603-173718625 CTCCTAAGTAGCTGGGTAGCTGG - Intronic
921702412 1:218283542-218283564 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
922553252 1:226512890-226512912 CTCCTAAGAAACCCAAGAGCTGG - Intergenic
1063459185 10:6204412-6204434 GTCCTAAGAAACGTAGTAGCCGG - Intronic
1064479171 10:15722018-15722040 CTCCTGAGTACCTGAGTAGCTGG - Intergenic
1065618122 10:27549930-27549952 CTCCCAAGTAGCCGAGTGGCTGG + Intergenic
1065770054 10:29069759-29069781 ATCCTAAGGAAAAAAGTAGCCGG - Intergenic
1066043886 10:31579749-31579771 CTGCCAAGTCACCAAGTCGCTGG - Intergenic
1066231490 10:33439183-33439205 CTCCTCAGCCCCCAAGTAGCTGG + Intergenic
1071736824 10:88310100-88310122 CTCCTCAGCCCCCAAGTAGCTGG - Intronic
1073080201 10:100854834-100854856 CTCCTAAGAAACCAAGGTCCTGG + Intergenic
1073376893 10:103043030-103043052 CTCCTTACTAACCAAGGAGACGG - Intronic
1073718561 10:106138729-106138751 CTCCTCAGCTCCCAAGTAGCTGG + Intergenic
1074471264 10:113728782-113728804 CTCCTATGTATCCCAGCAGCAGG + Intronic
1075041544 10:119111143-119111165 CTCCCAAGCTCCCAAGTAGCTGG - Intronic
1076108017 10:127839853-127839875 CTCCTCAGTCTCCGAGTAGCTGG + Intergenic
1078758164 11:14230909-14230931 CTCCTGAGTAGCTGAGTAGCTGG + Intronic
1079198695 11:18355626-18355648 CCTCCAAGTAACTAAGTAGCTGG + Intronic
1079409143 11:20170759-20170781 TGCCTCAGTTACCAAGTAGCTGG + Intergenic
1081782533 11:45723060-45723082 CTCCCAAGTAGCCAAGTAGCTGG - Intergenic
1082001692 11:47396572-47396594 CTCCCAAGTAGCTGAGTAGCTGG - Intergenic
1082044348 11:47712917-47712939 CTCCCAAGTACCCAGGTAGCTGG - Intronic
1083068192 11:59947369-59947391 CTCCTCAGTCTCCACGTAGCTGG + Intergenic
1083453156 11:62760119-62760141 CTCCCCAGTAGCCGAGTAGCCGG + Intergenic
1083867391 11:65463862-65463884 CTCCCAAGTTCCCAGGTAGCTGG - Intergenic
1083963629 11:66028773-66028795 CTCCCAAGTTCCCAAGCAGCTGG - Intergenic
1084658097 11:70531068-70531090 CACCTCAGCCACCAAGTAGCTGG - Intronic
1085646972 11:78230687-78230709 CACCTCAGTAACCAAGTAAGAGG + Intronic
1089882436 11:121787588-121787610 CTCATAAGTAAGCAAGTTGATGG - Intergenic
1092195264 12:6545781-6545803 CTCCTAAGTAACTAATGGGCAGG - Intronic
1094048538 12:26194874-26194896 CTCCTCAGTCTCCAAGTGGCTGG - Intronic
1094388853 12:29926758-29926780 CACCTCAGTCTCCAAGTAGCTGG + Intergenic
1095173363 12:39061022-39061044 CTCCCAAGTTCCCAAGTGGCTGG + Intergenic
1096349457 12:50883567-50883589 CTCCTTAGTTTCCAAGTAGCTGG - Intronic
1101327214 12:103726375-103726397 CGCCTCAGTTTCCAAGTAGCTGG - Intronic
1102005827 12:109588621-109588643 CCCCTAAGTAAACAAGGAGCTGG - Intronic
1103443021 12:120977716-120977738 CACCCAAGTACCCAAGTAGCTGG - Intergenic
1105269766 13:18861277-18861299 CTCATAGTTAACAAAGTAGCTGG - Intergenic
1107236530 13:38177163-38177185 CTCCTAAATCACTAAGGAGCAGG + Intergenic
1108371262 13:49771563-49771585 CTCCTCTGCACCCAAGTAGCTGG + Intronic
1110289249 13:73785227-73785249 CGCCTCAGACACCAAGTAGCTGG + Intronic
1111277117 13:85965061-85965083 CTCCTAAGTGACTAAGAGGCAGG - Intergenic
1111675766 13:91386698-91386720 CTCCTAGGAAGCCAAGTTGCTGG + Intergenic
1112355931 13:98675059-98675081 CTCCCAAGTACCCAAGTGGCTGG + Intergenic
1113144248 13:107189635-107189657 CTGATAAGTTACCAAGTACCAGG + Intronic
1113836092 13:113329461-113329483 CTCCTGAGTAGCTGAGTAGCTGG - Intronic
1117150623 14:52884001-52884023 CTCCTAAGTTACCAAGTCTCAGG + Intronic
1119095251 14:71824010-71824032 CTCTCAAGTAGCCAAGTAGCTGG - Intergenic
1120208927 14:81615396-81615418 CGCCTAAGCCTCCAAGTAGCTGG + Intergenic
1120417660 14:84240324-84240346 CTCCTAAGTAGCTAAGCAGCGGG - Intergenic
1121535622 14:94688806-94688828 CTCCCAAGTAGTTAAGTAGCTGG + Intergenic
1122703140 14:103603716-103603738 CTCCCAAGTTCCCAAGTAGGTGG - Intronic
1122747183 14:103905330-103905352 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
1123130682 14:105983097-105983119 CTCCTAAGTCAGCAACTACCTGG + Intergenic
1123580916 15:21714319-21714341 CTCCTAAGTCAGCAACTACCTGG + Intergenic
1123617565 15:22156942-22156964 CTCCTAAGTCAGCAACTACCTGG + Intergenic
1124701665 15:31919084-31919106 CTCCCAAGTAGCCAAGTAGCTGG + Intergenic
1125044259 15:35228540-35228562 CACCTCAGCCACCAAGTAGCTGG + Intronic
1125315589 15:38427849-38427871 CTCCTGAGTACCTGAGTAGCTGG + Intergenic
1125623278 15:41083589-41083611 CTCCCAAGTAGCTGAGTAGCTGG - Intronic
1126665644 15:51074499-51074521 TTCCTAAGTAACAAAGTAACAGG + Intronic
1127728384 15:61774641-61774663 CTCCCAAGTAGCCGGGTAGCTGG + Intergenic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1129972444 15:79790575-79790597 CTCCTACCTAGCCAAGTAGCAGG - Intergenic
1130351035 15:83091985-83092007 CTCCTGAGTAGCTGAGTAGCTGG - Intergenic
1131082442 15:89547901-89547923 CTCCCAAGCTCCCAAGTAGCTGG - Intergenic
1131261193 15:90888898-90888920 CTCCCGAGTAGCCAAGTAGCTGG + Intronic
1131687214 15:94781080-94781102 ATGCTAAGAAACCAGGTAGCTGG + Intergenic
1133329941 16:4966689-4966711 CTCCAAAGCAAACATGTAGCAGG + Intronic
1134587382 16:15423691-15423713 CTCCCAAGTAGCTGAGTAGCTGG + Intronic
1134883323 16:17767357-17767379 TGCCTCAGTCACCAAGTAGCTGG + Intergenic
1135491689 16:22914994-22915016 CTCTTGAGTGACAAAGTAGCTGG - Exonic
1136260757 16:29074037-29074059 CTCCTCAGTTTTCAAGTAGCTGG + Intergenic
1139438628 16:66952147-66952169 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
1140003639 16:71052734-71052756 CACCTCAGCCACCAAGTAGCTGG - Intronic
1140637167 16:76928829-76928851 CTGCTAAGTTACCAACTGGCAGG + Intergenic
1141093422 16:81146215-81146237 CTCCTAATTAAGCAAATGGCTGG - Intergenic
1141417995 16:83891771-83891793 CTGCTGCCTAACCAAGTAGCTGG - Intergenic
1142164292 16:88577471-88577493 CTCCTCAGTCACCAGGGAGCTGG + Exonic
1143129513 17:4668269-4668291 CTCCTGAGTAGCTGAGTAGCCGG - Intergenic
1143545904 17:7595399-7595421 CTCCCAAGTAGCCAAGTAGCTGG + Intronic
1145775704 17:27526902-27526924 CTCCTGAGTAACCAAGTCCTAGG - Intronic
1146188067 17:30738819-30738841 CACCTAAGTAACCAAAAAGGAGG + Intergenic
1146192102 17:30778298-30778320 CTCCCAAGTACCCAAGTAGCTGG - Intronic
1146337271 17:31985038-31985060 CTCCCAAGTACCCAAGTAGCTGG - Intronic
1146365852 17:32227112-32227134 CTCCTCAGCCTCCAAGTAGCCGG + Intronic
1147875893 17:43620161-43620183 CGCCTCAGTTCCCAAGTAGCTGG + Intergenic
1148008367 17:44453637-44453659 CACCTAAACCACCAAGTAGCTGG + Intronic
1148786230 17:50147504-50147526 CTCCAAAGTCACCAGGGAGCCGG + Intronic
1150643047 17:66962593-66962615 TTCCTGAGTAACCCAGTGGCTGG + Intergenic
1151447773 17:74178414-74178436 CTCCCAAGTACCCAGGTAGCTGG + Intergenic
1153211757 18:2774523-2774545 CACCTCAGCACCCAAGTAGCTGG + Intronic
1154073243 18:11174439-11174461 CTACTAAGTATACAATTAGCCGG + Intergenic
1154418284 18:14198701-14198723 CTCATAATTAACAAAGTAGCTGG + Intergenic
1155559429 18:27060071-27060093 CTCCTAAGTGCCCAAGTGGTGGG - Intronic
1156342327 18:36220804-36220826 CTCCCAAGTACCCAAGTAGCTGG - Intronic
1156428360 18:37041993-37042015 CACCTCAGCATCCAAGTAGCTGG + Intronic
1156721845 18:40079758-40079780 TGCCTAAGTATCCAATTAGCAGG - Intergenic
1158598792 18:58839341-58839363 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
1158603067 18:58871340-58871362 TTCCCAAGCAGCCAAGTAGCTGG + Intronic
1158925020 18:62247659-62247681 CTCCCAAGTAGCCAAGTAGCTGG + Intronic
1158951330 18:62498065-62498087 CTCCCAAGTAGCTGAGTAGCTGG - Intergenic
1161212288 19:3073627-3073649 TTCCTCAGCATCCAAGTAGCTGG + Intergenic
1161244191 19:3240129-3240151 CTCCTGAGTAGCTGAGTAGCTGG + Intronic
1161419661 19:4169712-4169734 CTCCCAAGTTCCCAAGTAGCTGG + Intronic
1161630051 19:5349504-5349526 CACCTCAGTCTCCAAGTAGCTGG + Intergenic
1162681430 19:12345795-12345817 CTCCCAAGTAGTCAAGTAGCTGG - Intergenic
1162862005 19:13513132-13513154 CTCCTGAGTAGCTGAGTAGCTGG - Intronic
1163281048 19:16317998-16318020 CTCCCAAGTTCCCAAGTAGTTGG + Intergenic
1163880045 19:19911464-19911486 CTCCTTATTATCCAAGTACCAGG - Intronic
1165053593 19:33159219-33159241 CACTTCAGTTACCAAGTAGCTGG - Intronic
1166412745 19:42567285-42567307 CTCCCGAGTAGCCACGTAGCTGG + Intergenic
1167241341 19:48345141-48345163 CTCCTAGGGAGCCAAGTACCTGG + Exonic
1167769721 19:51507552-51507574 CTCCTAAGTGACCCAGATGCTGG - Intergenic
1168445598 19:56409591-56409613 CTCCCAAGTAGCCAAGTAGCTGG + Intronic
1168657724 19:58143113-58143135 CTCCTGGGCTACCAAGTAGCTGG - Exonic
926041297 2:9675379-9675401 TTCAAAAGGAACCAAGTAGCTGG - Intergenic
927888247 2:26731453-26731475 CTCCTGAGTAGCCGAGTAGCTGG - Exonic
928625470 2:33135133-33135155 CCCCTAAGAAACCAAGAATCAGG - Intronic
929696936 2:44125512-44125534 CTACTGAGTAACTGAGTAGCTGG + Intergenic
930903858 2:56541911-56541933 CTCCCAAGTAGCTGAGTAGCTGG + Intergenic
931603086 2:64023467-64023489 TTCCAAAGTAACCAAGCGGCTGG - Intergenic
931952422 2:67380103-67380125 CTCCCAAGTAGCTGAGTAGCTGG - Intergenic
931973993 2:67622781-67622803 TTCCTAAGTAACCAATTATTAGG - Intergenic
932581139 2:72993370-72993392 CAGCAAAGTAGCCAAGTAGCTGG + Intronic
938404516 2:131022990-131023012 CACCTCAGTTCCCAAGTAGCTGG - Intronic
944166807 2:196731511-196731533 CTCCCAAGTAGCCAAGTAGCTGG + Intronic
944991896 2:205247709-205247731 CTCCAAAGTTATCAAGTGGCTGG - Intronic
945026551 2:205625049-205625071 CTCCTAACTACCCAAGTCTCTGG - Intergenic
945046510 2:205786780-205786802 TTCCTCAGTCACCAATTAGCAGG + Intronic
945686899 2:212982289-212982311 CTACTGAGTAGCCAAGGAGCGGG - Intergenic
945797796 2:214386258-214386280 CTCCCAAGTAGACAAGTAGCTGG - Intronic
948370932 2:237488545-237488567 CTCCTTAGTATCTAAGTACCAGG + Intronic
1169071408 20:2734292-2734314 CACCTTAGTTCCCAAGTAGCTGG - Intronic
1169446710 20:5677870-5677892 CGCCTCAGCTACCAAGTAGCTGG + Intergenic
1171419034 20:25005438-25005460 CATCAAAGTAAGCAAGTAGCTGG + Intergenic
1172135478 20:32683902-32683924 CTCCCAAGCTCCCAAGTAGCTGG + Intergenic
1173917638 20:46720610-46720632 TTCCTAAGTAATGAAGTAGTTGG + Intronic
1176962981 21:15180678-15180700 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
1177322966 21:19545936-19545958 CACCTCAGTGGCCAAGTAGCTGG + Intergenic
1177467324 21:21503397-21503419 CTCCTAAGTAACTAAGAGGTGGG + Intronic
1177777271 21:25581853-25581875 CTCCTGAGTAGCCAAGTAGCTGG - Intergenic
1177919929 21:27139762-27139784 CTCCAAAGCAAACAAGCAGCAGG - Intergenic
1180691495 22:17720289-17720311 CTCCTGAGTAGCTGAGTAGCTGG + Intronic
1181004497 22:20005703-20005725 CTCCCAAGTTCACAAGTAGCTGG - Intronic
1181499368 22:23307090-23307112 CTACTAACCAACCAAGTAACTGG - Intronic
1182142427 22:27972625-27972647 CTCCAAAGTAGCCAAGTTCCAGG - Intergenic
1183651275 22:39155252-39155274 CTCCCAGGTTCCCAAGTAGCTGG + Intergenic
1183814333 22:40287121-40287143 CTCCTCAGCCTCCAAGTAGCTGG + Intronic
950169338 3:10826903-10826925 ATCTTGAGTAACCAAGTAGCTGG - Intronic
950896788 3:16459478-16459500 CACCTTAGTCTCCAAGTAGCTGG - Intronic
951620180 3:24592922-24592944 CCCCTAAGCAGCCAAGTAGATGG + Intergenic
951641280 3:24838817-24838839 CTCCAAAGTAAACAAGTGCCTGG - Intergenic
952417189 3:33099961-33099983 CTCCTGAGTAGCTAAGTAGCTGG + Intergenic
954190510 3:48956819-48956841 CTCCTGATTTCCCAAGTAGCTGG + Intronic
954572533 3:51654160-51654182 CCCCTAGCTACCCAAGTAGCTGG + Intronic
954733781 3:52687744-52687766 CACCTCAGTCTCCAAGTAGCTGG + Intronic
955241357 3:57181247-57181269 CGCCTCAGCCACCAAGTAGCTGG - Intergenic
955295782 3:57733615-57733637 CTCCCAAGTAGCTGAGTAGCTGG - Intergenic
956647745 3:71473512-71473534 CTCACAAGTAACAAAGTGGCAGG + Intronic
957398125 3:79671052-79671074 CTCCTAATTAACAATGAAGCAGG + Intronic
960828965 3:121824262-121824284 CTACTAAGTGACCAACTGGCAGG + Intronic
961054223 3:123774263-123774285 CTCCTAAGCAACCTACAAGCAGG + Intronic
961098967 3:124182288-124182310 CTCCTAAGAGACCATGAAGCAGG - Intronic
961727576 3:128942794-128942816 CTCCCAAGTTCCCAAGTAGCTGG + Intronic
962606942 3:137040090-137040112 CTCCCAAGCTCCCAAGTAGCTGG - Intergenic
962777777 3:138679695-138679717 CTCCTCAGCTCCCAAGTAGCTGG + Intronic
963573960 3:147035368-147035390 CACCTAAGCCATCAAGTAGCTGG - Intergenic
964286816 3:155126882-155126904 CTCCCAAGTTCCCAAGTAGCTGG - Intronic
964938267 3:162122051-162122073 CTCCTCAGCCACCAAGTAGTTGG - Intergenic
965522958 3:169687027-169687049 CCACAAAGTAACCAAGTGGCAGG - Intergenic
966498222 3:180605094-180605116 ATCCTAAGCCACCTAGTAGCAGG + Intronic
966695961 3:182791228-182791250 CTCCCGAGTAGCCGAGTAGCTGG - Intergenic
967597017 3:191337995-191338017 CTCCTCAGTGACCAAATACCAGG + Intronic
968397644 4:258257-258279 TTTCTAAATAACCAAGTATCTGG + Intergenic
972471216 4:39406107-39406129 CTCCTCAGCCTCCAAGTAGCTGG - Intergenic
972519793 4:39843032-39843054 CTCCTGAGCTCCCAAGTAGCTGG + Intronic
976172708 4:82320843-82320865 CTCCTAAGTAGCTGGGTAGCTGG - Intergenic
977081382 4:92532962-92532984 CTCCCAAGTAGCTGAGTAGCTGG - Intronic
981800276 4:148647722-148647744 CTCCTGAGTAGCTGAGTAGCTGG - Intergenic
982156527 4:152527655-152527677 CTCCTGAGTAGCTGAGTAGCTGG - Intronic
982286214 4:153738296-153738318 CTCCTCAGCCTCCAAGTAGCTGG + Intronic
987548807 5:19351461-19351483 CACCTAAGCCTCCAAGTAGCTGG + Intergenic
988008988 5:25458813-25458835 CTCCTAAGTGACTAATTAGCGGG + Intergenic
990070555 5:51777373-51777395 CTCCCAAGTACTTAAGTAGCTGG - Intergenic
990164816 5:52982663-52982685 CTCCCAAGTAGCCAAGTAGCTGG - Intergenic
991454970 5:66793253-66793275 ATCCTAAGTAGCCTGGTAGCTGG + Intronic
992217456 5:74539990-74540012 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
992593699 5:78324121-78324143 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
992835279 5:80635102-80635124 CTCCTAAGTGACTAAGGGGCAGG - Intronic
993092600 5:83444840-83444862 CTCATAAATAACCAATTATCAGG - Intergenic
993720591 5:91317912-91317934 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
996759390 5:126971935-126971957 CTCCTAAGTTTCTAAGTTGCCGG - Intronic
1004216259 6:13706885-13706907 CTCCTGAGTAGCTGAGTAGCTGG - Intronic
1004911526 6:20290007-20290029 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
1007278458 6:40692761-40692783 TTCCTAAGTACCCAAGTCTCAGG + Intergenic
1009571469 6:65390759-65390781 CTCCCAAGTAACCGAGTAGCTGG - Intronic
1010243209 6:73636967-73636989 CTCCCAAGTAGCTAAGTAGCTGG - Intronic
1011675980 6:89734535-89734557 CTCCCAAGTAGCCAAGTAGCTGG - Intronic
1015554409 6:134445945-134445967 CGCCTTAGTTCCCAAGTAGCTGG + Intergenic
1016746156 6:147582242-147582264 CTCCCAGGTAGCCAAGTAGCTGG - Intronic
1020778844 7:12493086-12493108 CACCTCAGTCCCCAAGTAGCTGG - Intergenic
1024188707 7:46982991-46983013 ATCCTAAGTAAACAAGTATAAGG - Intergenic
1024415484 7:49100472-49100494 CTCCTAGTTCACCAATTAGCTGG + Intergenic
1026478115 7:70754373-70754395 CACCTTAGTCTCCAAGTAGCTGG - Intronic
1026823446 7:73565462-73565484 CTCTCAAGTAGCCCAGTAGCTGG + Intergenic
1028106945 7:86889501-86889523 CTACTAAGTAACTAACAAGCAGG + Intronic
1028168578 7:87567978-87568000 CTCCCAAGTAACCAAGTAGCTGG - Intronic
1029463598 7:100711239-100711261 CTCCCAAGTAGCTGAGTAGCTGG + Intergenic
1030204810 7:106942501-106942523 CTCCCCAGTAGCCCAGTAGCTGG + Intergenic
1030312734 7:108084350-108084372 CTCCTAGGTAACCATGAAGCTGG - Intronic
1033068222 7:138176657-138176679 CACCTCAGTCCCCAAGTAGCTGG + Intergenic
1033390418 7:140922938-140922960 CTCCTTAGAAATCAAGAAGCTGG + Intronic
1037665468 8:20965659-20965681 CTATTAAGTAACCAAGAAGTTGG - Intergenic
1038854824 8:31319903-31319925 CTCCCAAGGAACCAAATAGGAGG + Intergenic
1041707719 8:60864232-60864254 CTCCTGATTAGCCAAGTAGCTGG + Intronic
1042059569 8:64802125-64802147 CTCCTGATTAGCCAAGTAGCTGG - Intergenic
1042928096 8:73987446-73987468 CTCCTGAGCCTCCAAGTAGCTGG - Intergenic
1044448465 8:92305847-92305869 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
1048486490 8:134852531-134852553 CACCTCAGTCCCCAAGTAGCTGG - Intergenic
1049125809 8:140786682-140786704 CACCTAAGTAAGCAAGCAGTAGG + Intronic
1049962965 9:754053-754075 CTCCCAAGTAGCTGAGTAGCTGG - Intergenic
1052937918 9:34108866-34108888 CTCCTGAGTAGCTAAGTAGTTGG - Intronic
1055169262 9:73235276-73235298 CTCCCAAGCTCCCAAGTAGCTGG - Intergenic
1056472518 9:86919771-86919793 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
1057873955 9:98739355-98739377 CACCTCAGTCTCCAAGTAGCTGG - Intronic
1058845870 9:108958846-108958868 CTCCTGAGTAGCTGAGTAGCTGG + Intronic
1061142141 9:128773724-128773746 CTCCCAAGTTCCCAAGTAGCTGG - Intergenic
1188383644 X:29529477-29529499 CTCCCAAGCTCCCAAGTAGCTGG - Intronic
1189992871 X:46611198-46611220 TTCTTAAGTAAGCTAGTAGCAGG + Intronic
1192227552 X:69239503-69239525 CTCCCAAGTAACCAAGTAGCTGG + Intergenic
1194675878 X:96793281-96793303 CTCCTGAGTAGCTGAGTAGCTGG + Intronic
1194705743 X:97173276-97173298 CTTCTGAGTTCCCAAGTAGCTGG - Intronic
1196725896 X:118894938-118894960 CTCCTCAGTCCCCCAGTAGCTGG + Intergenic
1196729477 X:118926581-118926603 CACCTTAGCCACCAAGTAGCTGG + Intergenic
1196825528 X:119737388-119737410 CTCCCAAGTAGCCTAGTAGCTGG - Intergenic
1197872625 X:131073734-131073756 CTCCTCAGTTACTAAGCAGCTGG - Intronic
1198023078 X:132678377-132678399 CTCCTTAGAAATCAAGTAGAAGG + Intronic
1199435211 X:147805199-147805221 CTCATTAGTAACAAGGTAGCTGG + Intergenic
1201324670 Y:12743366-12743388 CTCCCAAGTAGCTGAGTAGCTGG + Intronic