ID: 911506373

View in Genome Browser
Species Human (GRCh38)
Location 1:98757466-98757488
Sequence CCTTATAAGAAGAGGAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3138
Summary {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911506373_911506378 0 Left 911506373 1:98757466-98757488 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 911506378 1:98757489-98757511 ACACCAGTCATATTGGATTAGGG 0: 235
1: 883
2: 1637
3: 2139
4: 1994
911506373_911506376 -7 Left 911506373 1:98757466-98757488 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 911506376 1:98757482-98757504 TATAAGGACACCAGTCATATTGG 0: 199
1: 801
2: 1703
3: 2220
4: 2101
911506373_911506377 -1 Left 911506373 1:98757466-98757488 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 911506377 1:98757488-98757510 GACACCAGTCATATTGGATTAGG 0: 209
1: 805
2: 1640
3: 1986
4: 1974

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911506373 Original CRISPR CCTTATAAGAAGAGGAAATC TGG (reversed) Intronic
Too many off-targets to display for this crispr