ID: 911506373 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:98757466-98757488 |
Sequence | CCTTATAAGAAGAGGAAATC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 3138 | |||
Summary | {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
911506373_911506378 | 0 | Left | 911506373 | 1:98757466-98757488 | CCAGATTTCCTCTTCTTATAAGG | 0: 9 1: 140 2: 478 3: 958 4: 1553 |
||
Right | 911506378 | 1:98757489-98757511 | ACACCAGTCATATTGGATTAGGG | 0: 235 1: 883 2: 1637 3: 2139 4: 1994 |
||||
911506373_911506376 | -7 | Left | 911506373 | 1:98757466-98757488 | CCAGATTTCCTCTTCTTATAAGG | 0: 9 1: 140 2: 478 3: 958 4: 1553 |
||
Right | 911506376 | 1:98757482-98757504 | TATAAGGACACCAGTCATATTGG | 0: 199 1: 801 2: 1703 3: 2220 4: 2101 |
||||
911506373_911506377 | -1 | Left | 911506373 | 1:98757466-98757488 | CCAGATTTCCTCTTCTTATAAGG | 0: 9 1: 140 2: 478 3: 958 4: 1553 |
||
Right | 911506377 | 1:98757488-98757510 | GACACCAGTCATATTGGATTAGG | 0: 209 1: 805 2: 1640 3: 1986 4: 1974 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
911506373 | Original CRISPR | CCTTATAAGAAGAGGAAATC TGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |