ID: 911507892 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:98776215-98776237 |
Sequence | TTTTATATACAGATGGTGCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
911507892_911507895 | 0 | Left | 911507892 | 1:98776215-98776237 | CCAGGCACCATCTGTATATAAAA | No data | ||
Right | 911507895 | 1:98776238-98776260 | TCCCATTGGTTCTGTTTCTCTGG | 0: 23 1: 324 2: 956 3: 1753 4: 7906 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
911507892 | Original CRISPR | TTTTATATACAGATGGTGCC TGG (reversed) | Intergenic | ||
No off target data available for this crispr |