ID: 911507892

View in Genome Browser
Species Human (GRCh38)
Location 1:98776215-98776237
Sequence TTTTATATACAGATGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911507892_911507895 0 Left 911507892 1:98776215-98776237 CCAGGCACCATCTGTATATAAAA No data
Right 911507895 1:98776238-98776260 TCCCATTGGTTCTGTTTCTCTGG 0: 23
1: 324
2: 956
3: 1753
4: 7906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911507892 Original CRISPR TTTTATATACAGATGGTGCC TGG (reversed) Intergenic
No off target data available for this crispr