ID: 911510056

View in Genome Browser
Species Human (GRCh38)
Location 1:98800456-98800478
Sequence CTAGGATTCTTACAGTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911510055_911510056 -10 Left 911510055 1:98800443-98800465 CCTAGGTTTCTTTCTAGGATTCT No data
Right 911510056 1:98800456-98800478 CTAGGATTCTTACAGTTTGATGG No data
911510053_911510056 4 Left 911510053 1:98800429-98800451 CCAGAATGGTGTTTCCTAGGTTT 0: 143
1: 638
2: 9931
3: 12596
4: 5216
Right 911510056 1:98800456-98800478 CTAGGATTCTTACAGTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911510056 Original CRISPR CTAGGATTCTTACAGTTTGA TGG Intergenic
No off target data available for this crispr