ID: 911516090

View in Genome Browser
Species Human (GRCh38)
Location 1:98869963-98869985
Sequence AATGCAGTTGAGATTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911516090_911516094 15 Left 911516090 1:98869963-98869985 CCTGGAAAAATCTCAACTGCATT No data
Right 911516094 1:98870001-98870023 TCTGATGAGGTCCTACCTAAGGG No data
911516090_911516092 2 Left 911516090 1:98869963-98869985 CCTGGAAAAATCTCAACTGCATT No data
Right 911516092 1:98869988-98870010 ATTAAGTAGGCTTTCTGATGAGG No data
911516090_911516097 30 Left 911516090 1:98869963-98869985 CCTGGAAAAATCTCAACTGCATT No data
Right 911516097 1:98870016-98870038 CCTAAGGGAAAATTACCAAGTGG No data
911516090_911516093 14 Left 911516090 1:98869963-98869985 CCTGGAAAAATCTCAACTGCATT No data
Right 911516093 1:98870000-98870022 TTCTGATGAGGTCCTACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911516090 Original CRISPR AATGCAGTTGAGATTTTTCC AGG (reversed) Intergenic
No off target data available for this crispr