ID: 911516094

View in Genome Browser
Species Human (GRCh38)
Location 1:98870001-98870023
Sequence TCTGATGAGGTCCTACCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911516090_911516094 15 Left 911516090 1:98869963-98869985 CCTGGAAAAATCTCAACTGCATT No data
Right 911516094 1:98870001-98870023 TCTGATGAGGTCCTACCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911516094 Original CRISPR TCTGATGAGGTCCTACCTAA GGG Intergenic
No off target data available for this crispr