ID: 911519164

View in Genome Browser
Species Human (GRCh38)
Location 1:98908224-98908246
Sequence CTGTAGTTCTTTAGGAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911519164 Original CRISPR CTGTAGTTCTTTAGGAGCAA AGG Intronic
907173602 1:52496938-52496960 CTCTAGTTCAAGAGGAGCAAGGG + Intronic
909636412 1:77821292-77821314 CAGTTGTTCTTTTGGACCAAGGG + Intronic
911519164 1:98908224-98908246 CTGTAGTTCTTTAGGAGCAAAGG + Intronic
916229578 1:162527354-162527376 CTGTAATTTTATAGGAGCAGTGG + Exonic
917011279 1:170475273-170475295 TGGAAGTTCTTTAGGACCAAAGG + Intergenic
918858982 1:189797164-189797186 TTGTATATCTTTATGAGCAATGG - Intergenic
919830674 1:201538632-201538654 CCGCAGTTCTTTAGGAGAAGGGG - Intergenic
920737090 1:208542639-208542661 CTGTAGGTCTTTAGGTGCACAGG - Intergenic
920863378 1:209730370-209730392 CTGAGGTTCCTTAGGAGGAAAGG + Intronic
921167315 1:212516425-212516447 CTGTAGTGCTTCAGGTGCTACGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921877673 1:220217261-220217283 CAGTAGTTCTTTTGGAGAAAAGG - Intronic
923141837 1:231167157-231167179 CTGGAGTTCTTTGAGAGCCATGG + Intronic
1066034024 10:31462532-31462554 CTTTAGTTCTTAAGGACCGATGG + Intronic
1067673122 10:48344345-48344367 CAGTAGCTCTTTAGGAATAAAGG - Intronic
1068561762 10:58522876-58522898 CTGTAGTTCTGTGGGATCGATGG - Intronic
1068903421 10:62296281-62296303 TTTTATTTCTTTAGGAGCATAGG - Intergenic
1069312575 10:67056528-67056550 CTGTACTTCTTAAGCATCAAAGG + Intronic
1069490548 10:68856963-68856985 CTGTAGTTGGTTAGGAGGATTGG - Intronic
1071256562 10:83877074-83877096 CTGGAGATCGTTTGGAGCAATGG - Intergenic
1072427757 10:95344244-95344266 CAGTGGTTCTTTGGGAGCTAGGG - Intronic
1072552183 10:96487424-96487446 CTGTATTCCTTTAGGACAAATGG + Intronic
1073056669 10:100707522-100707544 CTTTAGATCTTAAGGAGCAGTGG - Intergenic
1083475338 11:62911634-62911656 CTGTACGTCTCTAGGAGAAAGGG + Intronic
1083593356 11:63907808-63907830 CTGCAGTCCTTTTGGAGGAAAGG - Intronic
1087130834 11:94668147-94668169 CTGTTCATCTTTTGGAGCAAGGG - Intergenic
1088083164 11:105945112-105945134 CTGGAGTTCCTTAGGAAGAAGGG - Intronic
1088092154 11:106055001-106055023 ATATAGTTCTTTAGGAGAAGGGG + Intronic
1088112348 11:106277221-106277243 CTGCAGTTCTTTAGTTTCAAGGG + Intergenic
1089539736 11:119182553-119182575 CAGTAGGGCTTTAGGAGAAATGG - Intronic
1091433759 12:458097-458119 CTGCAGTTCTTTAGCAAAAAGGG - Intergenic
1092167581 12:6352381-6352403 CTGGAGATCTTTAGGAAGAAGGG + Intronic
1093286086 12:17265749-17265771 CTGTAGGTCTGCAGGAGCCAGGG + Intergenic
1093862828 12:24188789-24188811 CTGTAATTCATTAGTAGAAATGG - Intergenic
1095759060 12:45807003-45807025 CTGTAGCTCCTCAGGAGCTAAGG + Intronic
1097748207 12:63323223-63323245 CTGTAGGACTTGGGGAGCAAAGG + Intergenic
1097961585 12:65536536-65536558 CTCTAGGTCTTCATGAGCAATGG - Intergenic
1099351325 12:81572687-81572709 TGGTAGTTCTCTAGTAGCAATGG + Intronic
1102549398 12:113680423-113680445 CTGTAGTGGTCCAGGAGCAATGG - Intergenic
1102962574 12:117102222-117102244 CAGGAGTTCTTCAGGAGCGAAGG - Intergenic
1108096589 13:46908176-46908198 CTCTAGTTCTATAGGACCTATGG - Intergenic
1108331174 13:49386082-49386104 CTGTAGTTCTATAGCACTAAGGG + Intronic
1111880616 13:93951841-93951863 CTGGAGATCATTAGAAGCAAAGG + Intronic
1113575592 13:111393173-111393195 CTGTAGTTCATAAGGAGAGAGGG - Intergenic
1113578153 13:111409012-111409034 ATGTATTTCTCTGGGAGCAAAGG + Intergenic
1114196495 14:20481603-20481625 CTCCAGTTTTTTAGAAGCAAAGG + Intergenic
1114260096 14:21030393-21030415 CTGTAGTTGCGTAGGTGCAATGG + Intronic
1115367605 14:32576260-32576282 CTGGAGGTCATAAGGAGCAAGGG - Intronic
1115797426 14:36954365-36954387 CTGTAGTTAGTAAGGAGAAATGG - Intronic
1117833447 14:59777640-59777662 CAGGAGTTCCTTAGGACCAAAGG + Intronic
1120617090 14:86720674-86720696 CTGTAGCTCTTCTGGGGCAAAGG - Intergenic
1121404063 14:93707938-93707960 CTGTAGAACTTTAGAAGGAATGG - Intergenic
1121563773 14:94893746-94893768 CTGGGGTTATTTAGGAGCAGAGG - Intergenic
1123884525 15:24711942-24711964 TGGTAGTACTTTAGGAACAAAGG + Intergenic
1127337404 15:58002266-58002288 CTGTTGATCTCTAGCAGCAAGGG - Intronic
1127534586 15:59878276-59878298 CGGTAGTTGGTGAGGAGCAAAGG - Intergenic
1128833158 15:70787637-70787659 ATGTTGTTCTTTAAGAGTAAGGG + Intergenic
1128846952 15:70907402-70907424 CGGGAGTTCTTTAGTATCAACGG - Intronic
1130157488 15:81364183-81364205 CAGTAGTGCTTGAGGAGCCAGGG + Intronic
1130431076 15:83847393-83847415 CTGTCATTCTGTAGGAGCAGTGG - Intronic
1132231204 15:100185583-100185605 TTAGAGTTCTTTAGAAGCAATGG - Intronic
1133723279 16:8514891-8514913 CTGTAGTTCTGTTGTAGCAATGG - Intergenic
1134008079 16:10831730-10831752 CAGTAGGTTTTCAGGAGCAATGG - Intergenic
1134071520 16:11262985-11263007 ATGCAGTTCTTAAGGAGCATGGG - Intronic
1137878028 16:52016102-52016124 CTTTTCTTCTTTAAGAGCAAAGG - Intronic
1139447313 16:67005881-67005903 CTGTTCTTCCTTAGGAACAAGGG + Intronic
1140156623 16:72435502-72435524 ATGTAATTCTTCAGGATCAATGG + Intergenic
1141612149 16:85187838-85187860 CTGTGGTTATTTAGGGGCAGAGG + Intergenic
1144857538 17:18277983-18278005 CGGCAGTTCTTTAAGTGCAACGG - Exonic
1145028303 17:19485901-19485923 CTGTAGCTTCTTTGGAGCAAAGG + Intergenic
1147391307 17:40111080-40111102 CTGTATTTCTTTAGACTCAATGG + Intergenic
1147407754 17:40225267-40225289 CTGTAGTTCCTCAGGCTCAATGG - Intronic
1149251581 17:54776567-54776589 CTGTAGAACCTTAGAAGCAAGGG - Intergenic
1149901666 17:60485521-60485543 CTGTATTTCTGTAGGATCAGTGG + Intronic
1151124842 17:71833293-71833315 TTGTATTTCTTTAGTAGAAACGG - Intergenic
1155106970 18:22676747-22676769 CTGTAGTTGGTTAAGAGTAAGGG - Intergenic
1157210351 18:45736863-45736885 CTGTAGATGTTTAGGGGAAAAGG - Intronic
1158468932 18:57717371-57717393 TTGTATTTTTTTAGTAGCAATGG - Intronic
1159062686 18:63532531-63532553 CTGTATGTCTATAGGAGCAGTGG + Intergenic
1160610581 18:80081813-80081835 CTGTATTTCTCCAGAAGCAAGGG - Intronic
1161338190 19:3725931-3725953 CTGCAGTTCTGAAGGAGCCAGGG - Intronic
1166077441 19:40421748-40421770 CTGTATTTATTGAGGAGCGAAGG - Exonic
930278869 2:49345798-49345820 CTGTTGTTCTTCTGGAACAACGG + Intergenic
931774246 2:65526468-65526490 CTGTTGTCCTTTGGGAACAATGG + Intergenic
932472731 2:71972459-71972481 CTGTAGTGTTTCAGGAGCACAGG - Intergenic
935766783 2:106375656-106375678 CTGTAGCACTTTAGAAGGAAGGG + Intergenic
936366222 2:111859176-111859198 CTGTAGCACTTTAGAAGGAAGGG - Intronic
939782890 2:146471481-146471503 CTGTAATACTTTAAGTGCAAGGG - Intergenic
941360923 2:164550303-164550325 ATGTGGTTATTTAGGAACAAAGG - Intronic
947294064 2:228611711-228611733 CTGTTGTTTTCTTGGAGCAATGG - Intergenic
947956015 2:234192198-234192220 CTGCAGTTCTGTAGGAGGCATGG - Intergenic
1169940250 20:10929190-10929212 CTGTAGTTCTGTAGGAACATAGG - Intergenic
1169972255 20:11280568-11280590 CTGTTTTTCTTTAGGAACATTGG + Intergenic
1172184416 20:33022398-33022420 GAGTAGTTCTTAAGGAACAAGGG - Intronic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1175418809 20:58818376-58818398 CTGGAGATCTTTAGGAGGATGGG + Intergenic
1177892397 21:26822335-26822357 CTGTGGGTCTTTAATAGCAAAGG + Intergenic
1178568674 21:33713732-33713754 CTGGGGTTCCTTAGGAGCCAAGG + Intronic
1180181345 21:46119924-46119946 CTGTTGTTCTCTGGGAGGAATGG - Intronic
1180898610 22:19355163-19355185 CTTTGGTTCTTAAGGACCAAAGG + Intronic
1183338030 22:37262032-37262054 CTGTAGCTCTTTGGGTGCTATGG + Intergenic
1183759894 22:39806635-39806657 CTGTAGTTTTTTGAGAGCAAGGG - Intronic
954877687 3:53813481-53813503 GTGTAGCCCTTTAGGAGAAATGG - Exonic
959396585 3:105847197-105847219 CTGTAGTCCTTTAAGGGGAAAGG + Intronic
959830787 3:110859719-110859741 CTGTAATTCTTTATGAGCAAGGG - Intergenic
961333232 3:126155157-126155179 CTGTTCCTCTTTAGGAGGAATGG - Intronic
964516889 3:157520559-157520581 CTCTGGTTCTTTATAAGCAATGG + Intronic
965448742 3:168809897-168809919 ATCTTGTTCTTCAGGAGCAATGG + Intergenic
966098435 3:176236004-176236026 AAGTAATTCTTTAGGAGAAAAGG - Intergenic
966357912 3:179101823-179101845 CAGTACTTCTCTAGGAGCAGGGG - Intergenic
970366170 4:15360309-15360331 CTTTATTTCCCTAGGAGCAATGG - Intronic
972345350 4:38188325-38188347 CTGTTTGCCTTTAGGAGCAATGG + Intergenic
973148012 4:46853149-46853171 CTGTATTTCCTTAGGAGCAATGG + Intronic
973681290 4:53323298-53323320 CTGTAGTTCTAGAGTATCAAAGG - Intronic
976900720 4:90171908-90171930 CTGCAGTTGTTTACGAGGAAGGG + Intronic
979158902 4:117433084-117433106 TTGGAGTTCATTAGCAGCAATGG + Intergenic
980423842 4:132599594-132599616 ATTTACTTCTTCAGGAGCAATGG + Intergenic
980591722 4:134898230-134898252 ATGTAATTTTTTTGGAGCAAAGG + Intergenic
981737323 4:147966583-147966605 CTGTATTTCCTTAAAAGCAAGGG - Intronic
982487162 4:155979845-155979867 TTGTAGTACTTTATAAGCAAAGG - Intergenic
984002527 4:174268155-174268177 CTGTAATTCCCTAGGAACAATGG - Intronic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
984216102 4:176914349-176914371 TTGTATTTCTGTAGGAGCAGTGG - Intergenic
984241243 4:177222120-177222142 CTGCTCTTCATTAGGAGCAATGG - Intergenic
984627056 4:182019362-182019384 CTGTAGGTCATGAGGAGCAGAGG - Intergenic
985972121 5:3386696-3386718 CTGTATTTCATTAGAAACAAAGG + Intergenic
986596795 5:9431020-9431042 CTTAAGTACTGTAGGAGCAAAGG + Intronic
988066064 5:26229586-26229608 CTGTAGTTCATTAACAGTAATGG - Intergenic
988458560 5:31411127-31411149 ATTTACTTCTTTAGGAGCATTGG + Intronic
988551739 5:32206424-32206446 CTGTAATTGTTTAGGAAAAATGG - Intergenic
989988233 5:50728557-50728579 GTGTAGTTCTTTAGGAACTGAGG - Intronic
991752265 5:69820130-69820152 TTGTAGGACTTTAGGAACAAAGG - Intergenic
991944977 5:71890996-71891018 CTGTATTTATTGAGAAGCAATGG + Intergenic
994470213 5:100194281-100194303 CTGTATTTCTGTAGGATCAGTGG - Intergenic
998755704 5:145376711-145376733 TTGTATTTCTGTAGGATCAATGG + Intergenic
1006649281 6:35537494-35537516 CTGGAGTTCTGAAGTAGCAAAGG + Intergenic
1007122999 6:39399258-39399280 CTGTAGCTCTTTGGGAACAGTGG + Intronic
1008917382 6:56803193-56803215 CTGTAGTATTTTAGGAGCACAGG - Intronic
1011049389 6:83127506-83127528 CTTTTGTTGTTTAGGAGCACCGG + Intronic
1011138871 6:84131116-84131138 CAGTAGTCCTTCAGGAGCAGTGG + Intronic
1013899599 6:115138521-115138543 CTGTAGCTTTTTAAGAGGAAAGG - Intergenic
1016585013 6:145674285-145674307 CTGTAGGTCTGTAGGACCAAAGG + Intronic
1016585027 6:145674391-145674413 CTGCAGTTCCTTGGGGGCAATGG + Intronic
1017197563 6:151717911-151717933 CAGTAATTCTCAAGGAGCAAAGG + Intronic
1019131610 6:169881061-169881083 CTTTAGTCCTGGAGGAGCAAAGG + Intergenic
1020244131 7:6417706-6417728 CTGTAGTTGTTTTAGAGAAATGG - Intronic
1021355158 7:19645017-19645039 CTGAAGTTCTTTGGAAGAAATGG - Intergenic
1021954041 7:25806019-25806041 CTGTAGTTGTTTAGCAGAGACGG - Intergenic
1022239334 7:28494468-28494490 ATATATTTCTTTAGGAGCTATGG - Intronic
1027051915 7:75026000-75026022 CTGTAGTTCTATCTGAGCACCGG + Intergenic
1027287424 7:76661500-76661522 CTGTAGTTCCTCAGGTGCATAGG - Intergenic
1032373169 7:131380937-131380959 CTGTATTTTTCTAGGAGCAATGG - Intronic
1033110753 7:138572920-138572942 CTGTTGTTTTGTAGGAGAAAAGG - Intronic
1033308763 7:140244071-140244093 TTGTATTTTTTTAGTAGCAATGG + Intergenic
1035588484 8:795174-795196 CTGTGTTTCTTCAGGAGCAAGGG - Intergenic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1037887405 8:22602186-22602208 CTGTCTTTCTGAAGGAGCAAAGG + Exonic
1041889929 8:62857891-62857913 CTGTAGTCATTTAGAAGAAAGGG + Intronic
1043281524 8:78473123-78473145 CTGTATTTCCCTAGGAGCAATGG + Intergenic
1043413501 8:80024795-80024817 CTGTAGTTCCTGAAGAACAAGGG - Intronic
1043859950 8:85304399-85304421 CTGGGGCTCCTTAGGAGCAAGGG + Intergenic
1044614365 8:94124156-94124178 CTGTATTTCTGTAGGATCAGCGG + Intergenic
1044682842 8:94799419-94799441 CTTAAGTTCTTCTGGAGCAAAGG + Intergenic
1046575624 8:116025226-116025248 TTGCAGTGCTTTAGGAGAAATGG - Intergenic
1047987130 8:130246734-130246756 CTGTAGTTGTTTAGGATGACAGG - Intronic
1051447101 9:17151979-17152001 CTGTATTTCTTTGGGATCAGTGG + Intronic
1055496912 9:76864434-76864456 ATGTATTTCTTTAGGATCCAGGG - Intronic
1056617323 9:88179532-88179554 CTGTATTTCTCCAGGAGCAGTGG - Intergenic
1056934267 9:90903796-90903818 CTGTAGATCTTGAGGAGCCGCGG - Intergenic
1057944526 9:99313654-99313676 TTGTAGTTTTTTAGTAGAAACGG + Intergenic
1059753016 9:117266585-117266607 GTGTAGTTATCTAGGAGAAAAGG - Intronic
1188662154 X:32774114-32774136 CTGAAATTCCTTAGGAGAAATGG + Intronic
1188792637 X:34423210-34423232 CTGTACTTCTTTGGGGTCAATGG - Intergenic
1189706126 X:43760571-43760593 CTGGAGTTGTGTGGGAGCAATGG - Intergenic
1191073627 X:56429094-56429116 CTGTAGCTCTTCACCAGCAATGG - Intergenic
1191919261 X:66236938-66236960 CTGTATTTCTGTAGGGTCAATGG + Intronic
1193133406 X:77942986-77943008 TTGTATTTTTTTAGTAGCAACGG + Intronic
1193176952 X:78405278-78405300 CTGTATTTCTGTAGGGGCAGGGG - Intergenic
1198137698 X:133770682-133770704 CTGTAGTTTGTTAGGAGCTTGGG - Intronic
1198462776 X:136879549-136879571 CTTTAGTTATTAAGGAACAATGG - Intronic
1198495664 X:137190099-137190121 GTTTAGTTCTTTAGGAAAAAGGG + Intergenic
1200740008 Y:6844117-6844139 CAGTAGTTATTCAGGAGCATAGG + Intergenic