ID: 911524888

View in Genome Browser
Species Human (GRCh38)
Location 1:98972801-98972823
Sequence GGCTAGTGTAGGCCTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911524882_911524888 -4 Left 911524882 1:98972782-98972804 CCTGATGGCCCTGATCTGGGGCT No data
Right 911524888 1:98972801-98972823 GGCTAGTGTAGGCCTGGGCATGG 0: 1
1: 0
2: 1
3: 20
4: 227
911524876_911524888 23 Left 911524876 1:98972755-98972777 CCTCAAGTGATGAATGATTTGTC No data
Right 911524888 1:98972801-98972823 GGCTAGTGTAGGCCTGGGCATGG 0: 1
1: 0
2: 1
3: 20
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911524888 Original CRISPR GGCTAGTGTAGGCCTGGGCA TGG Intronic
901684738 1:10937615-10937637 GGGCAGTGTAGGGCTGGGCCCGG - Intergenic
902192176 1:14771533-14771555 GTCTAGGATAGGCCTGGGCGAGG + Intronic
903535619 1:24064372-24064394 GGCTTGTCTGGGCCTGGGGAAGG + Intronic
903662174 1:24984880-24984902 TGCAAGTGTGGGCCTGGGCAGGG - Intergenic
904405612 1:30286291-30286313 GGCTCGTGCTGGGCTGGGCAAGG + Intergenic
904458599 1:30662255-30662277 GGCTCGTGCTGGGCTGGGCAAGG + Intergenic
906155894 1:43613744-43613766 GGTTTGGGTAGGCCTGGGCCAGG - Intronic
906449371 1:45931782-45931804 GGCTGGGGTGGGACTGGGCATGG - Intronic
907426817 1:54384998-54385020 CTCCAGAGTAGGCCTGGGCAGGG + Intronic
908751040 1:67423314-67423336 AGTTAGTGAAGGGCTGGGCAAGG + Intronic
910801813 1:91154538-91154560 GGCTGCTGTAAGCCTGGGAATGG - Intergenic
911524888 1:98972801-98972823 GGCTAGTGTAGGCCTGGGCATGG + Intronic
913957446 1:143318613-143318635 GGCTAGGGTAGCACAGGGCATGG + Intergenic
914051760 1:144143977-144143999 GGCTAGGGTAGCACAGGGCATGG + Intergenic
914127437 1:144822564-144822586 GGCTAGGGTAGCACAGGGCATGG - Intergenic
915835219 1:159171276-159171298 AGCCACTGCAGGCCTGGGCAAGG - Intergenic
917967569 1:180188114-180188136 AGCTAGTGAGGGGCTGGGCAGGG + Intronic
919803171 1:201365572-201365594 GGGTTGAGTAGGCCTGGGCTGGG - Intronic
920884014 1:209908859-209908881 AGATAGTTTAGGGCTGGGCATGG + Intergenic
922782467 1:228264034-228264056 GGGGAGAGAAGGCCTGGGCAGGG - Intronic
923517538 1:234710101-234710123 GGCTGGGGTGGGGCTGGGCAGGG - Intergenic
924273931 1:242365551-242365573 GCCTTATGTAGGCCTGGGCGAGG - Intronic
924707531 1:246511733-246511755 GGCTGGGGGTGGCCTGGGCAGGG + Intergenic
1062910574 10:1209269-1209291 TGATGGTGTAGGCGTGGGCATGG - Intronic
1062910625 10:1209473-1209495 CGACAGTGTAGGCATGGGCATGG - Intronic
1063383514 10:5601699-5601721 GGCAAGTGAGGGCCTGGTCAGGG - Intergenic
1066695898 10:38077201-38077223 GGGCAGTGCAGGCCTGGGCCTGG + Intergenic
1066961395 10:42230809-42230831 GGCTAGGGTAGCACAGGGCATGG + Intergenic
1066996643 10:42570359-42570381 GGACAGTGTAGGCCTGGGCCTGG - Intergenic
1067278912 10:44856816-44856838 GGCTGGTGCAGGCTTGGGGAAGG - Intergenic
1067548876 10:47219242-47219264 GGCTTGAGCAGGCCTGGTCAGGG - Intergenic
1067804311 10:49382551-49382573 GCCCAATCTAGGCCTGGGCAAGG - Intronic
1069809825 10:71150074-71150096 TCCTAGTGTAGGCCTAGGTATGG + Intergenic
1072952480 10:99859892-99859914 GGTTCGGGTAGGGCTGGGCACGG + Intergenic
1073718667 10:106139752-106139774 GGCTACAGAAGGCCTGGTCAAGG + Intergenic
1076110831 10:127858082-127858104 GGATAGTGAAGGCCTTGGCAAGG + Intergenic
1076785136 10:132745820-132745842 GGGTATGGTGGGCCTGGGCATGG + Intronic
1077785787 11:5382259-5382281 GGGTAGTGTAAGCAAGGGCATGG - Intronic
1077823261 11:5773897-5773919 GTGTAGTGAAGGTCTGGGCATGG - Intronic
1078400681 11:11023741-11023763 GGCTTCAGCAGGCCTGGGCAGGG + Intergenic
1081235244 11:40639299-40639321 GGCTGGTGCAGGCCAGTGCAAGG - Intronic
1083340979 11:61958208-61958230 GGCCAGGGTAGGCCTTGGCTGGG - Exonic
1083556200 11:63630505-63630527 GGCTATTTTTGGGCTGGGCACGG + Intronic
1083763267 11:64830155-64830177 GGCTAGGGTGGGCGTGGGCAGGG - Intronic
1084024370 11:66438647-66438669 GCCTAGTGGGGGCCCGGGCATGG + Exonic
1084031047 11:66480672-66480694 GGCTTCTGGAGGCCGGGGCAGGG + Intronic
1084183060 11:67456096-67456118 TGCTCATGTTGGCCTGGGCAGGG - Intronic
1084619826 11:70262190-70262212 AGCTAGGGCAGGGCTGGGCATGG - Intergenic
1085261055 11:75204944-75204966 GGCGAGTGCAGACCTGGGCTGGG - Exonic
1087357447 11:97112472-97112494 GAATAAGGTAGGCCTGGGCATGG + Intergenic
1087943266 11:104127040-104127062 AGCTAGTGTGGGTATGGGCACGG - Intronic
1091399217 12:172420-172442 GGCTAGGGCAGGGCAGGGCAGGG - Intronic
1091792765 12:3281108-3281130 GACTGGGGTTGGCCTGGGCAGGG + Intronic
1091883286 12:3997256-3997278 TGGTAATGTAGGCCAGGGCATGG + Intergenic
1092338533 12:7655576-7655598 GCCTAATGTAGACATGGGCATGG + Intronic
1094233476 12:28136085-28136107 GGAGAGCCTAGGCCTGGGCAAGG + Intronic
1094687312 12:32730409-32730431 AGCAAGAGTAGGGCTGGGCACGG + Intronic
1096559303 12:52424362-52424384 GGCTGGCTTAGGCCTGGGAATGG + Exonic
1096573205 12:52536491-52536513 GAGTATTGTAGGGCTGGGCACGG + Intergenic
1096762088 12:53850305-53850327 GGCAGGTGTAGACCCGGGCAGGG + Intergenic
1096866989 12:54570484-54570506 GGCTAGGCTGGGCGTGGGCATGG - Intronic
1099368172 12:81795725-81795747 GGCTAAGTGAGGCCTGGGCAGGG + Intergenic
1101274964 12:103189577-103189599 GCATAGTGTAGGCCTGGGGTAGG + Intergenic
1101446817 12:104742632-104742654 GGCTTCCGGAGGCCTGGGCAGGG - Intronic
1102111741 12:110370605-110370627 GGCTGGTGGTGGCCTGGGCGGGG + Intergenic
1102243373 12:111339448-111339470 GTCTCTTGTAGGGCTGGGCAAGG + Intronic
1104623155 12:130333315-130333337 GGATACAGCAGGCCTGGGCAGGG + Intergenic
1105504517 13:20998637-20998659 GGTTAGAGGAGGCCTGGGCCCGG - Intronic
1108072701 13:46644741-46644763 CCCCAGTGTAGGCCTGGGCATGG + Intronic
1108406168 13:50104565-50104587 GGCTAGTGGAGACATGGGTATGG - Intronic
1108562913 13:51664367-51664389 TGCTAGTCTCAGCCTGGGCAGGG + Intronic
1113812524 13:113151230-113151252 GAATAGTCTAGGCCTGGGCCAGG + Intergenic
1113837271 13:113336597-113336619 AGCTAGTGTAGGTGTAGGCAGGG - Intronic
1114522588 14:23348391-23348413 GGCTGGGGTAGGCCTGGACCAGG + Intronic
1117253492 14:53956352-53956374 GGACAGAGAAGGCCTGGGCAGGG + Intronic
1118722672 14:68605556-68605578 GGCTAGAGGAGGCCTGGGACAGG - Intronic
1121250113 14:92493142-92493164 CTCTAGAGAAGGCCTGGGCAAGG + Intronic
1123110840 14:105866259-105866281 AGCCAGTGCAGGCCTGGGGAGGG - Intergenic
1123443648 15:20306639-20306661 GGCTAGTGTAGGGCCAGGCCAGG - Intergenic
1125771170 15:42166969-42166991 GCCTAGAGCAGGCCTGGGCCAGG - Intronic
1132570993 16:643917-643939 GGCTAGAGGAGCCCTGGGCAGGG + Intronic
1132883799 16:2173626-2173648 GACTAGTGTAGGCAAGGCCAGGG - Intronic
1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG + Intronic
1134510003 16:14838562-14838584 TGCTAGTGTAGGAAAGGGCATGG - Intronic
1134974191 16:18557614-18557636 TGCTAGTGTAGGAAAGGGCATGG + Intronic
1135782282 16:25314181-25314203 TGCTAGTGCAGGCCTGAGCCTGG + Intergenic
1138227607 16:55310869-55310891 AACTAGTGTATGCCTGGGCAAGG + Intergenic
1139922062 16:70466826-70466848 GGCAGGTGAAGGCCTGGGCCAGG + Intronic
1142062599 16:88040467-88040489 GGCTTCTGTAGGCATGGGGACGG - Intronic
1142196320 16:88740846-88740868 GGCAAGTGTGGGCCCAGGCAGGG + Intronic
1143404671 17:6669331-6669353 GGCTTGTCTGGACCTGGGCACGG + Intergenic
1144728154 17:17512006-17512028 GGCTGGTGTAGGTCTGGGGAGGG - Intronic
1145366747 17:22271722-22271744 GGCTAGTGCCCACCTGGGCATGG + Intergenic
1146799033 17:35804075-35804097 TGCTAGTGTTGGACTGGGCGTGG + Intronic
1148851986 17:50560049-50560071 GGCTAGGGTAGGCATGGTCTGGG - Intergenic
1151646918 17:75438998-75439020 GACTAGTGATGGCCTGGGCTGGG + Intergenic
1152332342 17:79680472-79680494 GGCTAGGGCAGGGCAGGGCAGGG - Intergenic
1153801773 18:8677315-8677337 TGCTACTGTGGGGCTGGGCATGG - Intergenic
1154414735 18:14170872-14170894 GGGCAGTGTTGGGCTGGGCAGGG + Intergenic
1155834164 18:30558034-30558056 GACTAGTCTTTGCCTGGGCATGG + Intergenic
1159065110 18:63560918-63560940 GGCTAGTTTAAGACTGGGGATGG + Intronic
1160554027 18:79714684-79714706 TGCTGGTGGGGGCCTGGGCAGGG - Exonic
1161291127 19:3493956-3493978 GGCTGGGGCAGGGCTGGGCAGGG + Intronic
1162478522 19:10915064-10915086 GGCTTGTGCAGGCAGGGGCAGGG + Intronic
1164769077 19:30794484-30794506 GGTTAGAGGAGGGCTGGGCAGGG + Intergenic
1164932568 19:32186773-32186795 GGCTACTCCAGGCCTGGGCCAGG + Intergenic
1165950765 19:39472941-39472963 GGCCTGTGGAGGCCTGGGGAGGG + Intronic
1166317630 19:41997950-41997972 GGCGAGTGTGTGCCTGGGCCGGG - Intergenic
1167538761 19:50072279-50072301 GGCAAGACGAGGCCTGGGCAGGG + Intergenic
1168403827 19:56100620-56100642 GGCGGGTGTTGGCCTGGCCATGG - Intronic
1168442799 19:56385393-56385415 TGTTAGTGTGGGGCTGGGCATGG + Intronic
1202691156 1_KI270712v1_random:96401-96423 GGCTAGGGTAGCACAGGGCATGG + Intergenic
927692807 2:25220182-25220204 GGCTACTTGAGGGCTGGGCACGG + Intergenic
928004538 2:27552102-27552124 AGCTAGTCTAGGGCTGGGCACGG - Intronic
928308954 2:30194067-30194089 GGCAAGTGTTGGCTGGGGCAGGG - Intergenic
929437380 2:41938991-41939013 GGCCAGTGTAGGCTGGGGGAAGG - Intronic
932238881 2:70142183-70142205 GGCGGGTGTAGGCCCGGGGACGG + Intergenic
933955234 2:87357549-87357571 GGCTAGGGTAGCACAGGGCATGG - Intergenic
933973467 2:87489238-87489260 GTCTAGTGCAAGGCTGGGCATGG - Intergenic
934239424 2:90253763-90253785 GGCTAGGGTAGCACAGGGCATGG - Intergenic
934273761 2:91562935-91562957 GGCTAGGGTAGCACAGGGCATGG + Intergenic
934323529 2:91986300-91986322 GGCTAGGGTAGCACAGGGCATGG - Intergenic
934461865 2:94217117-94217139 GGCTAGGGTAGCACAGGGCATGG - Intergenic
935207895 2:100912517-100912539 GACTAGGGTAGGGCTTGGCAGGG + Intronic
935500443 2:103831665-103831687 GACTAGTGCAAGCCTGGGAATGG - Intergenic
936320258 2:111460975-111460997 GTCTAGTGCAAGGCTGGGCATGG + Intergenic
937125629 2:119473492-119473514 GGCCAGATTAGGCCTGGGGAAGG + Exonic
937997831 2:127708490-127708512 GGCAAGTGGAGTCCTGTGCAGGG + Intronic
939706863 2:145465734-145465756 AGCTAATGAAGGGCTGGGCACGG + Intergenic
942262366 2:174181559-174181581 GGATGGGGTTGGCCTGGGCAGGG + Intronic
946785011 2:223234674-223234696 GGCTGGTGGTGCCCTGGGCAGGG - Intergenic
947363747 2:229372740-229372762 GGCTCCTGTAGGACGGGGCAGGG + Intronic
947584012 2:231340912-231340934 AACAAGTGTAGGGCTGGGCATGG + Intronic
947931486 2:233968548-233968570 GGCTGGAGTAGCCCTAGGCAGGG + Intronic
948232111 2:236356254-236356276 GGCAAGGGAAGGCCAGGGCAGGG - Intronic
948232333 2:236359066-236359088 GGCAAGGGAAGGCCAGGGCAGGG + Intronic
1169142938 20:3236265-3236287 AGGTAGTGCAGGCCTGGGCCTGG - Intronic
1169197923 20:3693315-3693337 AGCTAGTGGAGCACTGGGCAAGG - Intronic
1171224006 20:23425383-23425405 GGCCACTGCAGACCTGGGCAGGG - Intergenic
1174040255 20:47694354-47694376 GGGTAGAGAAGGCCTGGGCCGGG + Intronic
1174538865 20:51273908-51273930 GCCTGGTGCAGGCCTGGGGACGG + Intergenic
1174685169 20:52447704-52447726 AGATATTTTAGGCCTGGGCACGG + Intergenic
1175800996 20:61800930-61800952 ACATAGGGTAGGCCTGGGCATGG + Intronic
1176240351 20:64073013-64073035 GTCTGGTGGAGGCCAGGGCATGG + Intergenic
1176592955 21:8660099-8660121 GGCTAGGGTAGCACAGGGCATGG - Intergenic
1176858285 21:13987382-13987404 GGGCAGTGTTGGGCTGGGCAGGG - Intergenic
1180275807 22:10637242-10637264 GGCTAGGGTAGCACAGGGCATGG - Intergenic
1180550288 22:16532171-16532193 GGCTAGGGTAGCACAGGGCATGG - Intergenic
1181354380 22:22289637-22289659 GGCTAGGGTAGCACAGGGCATGG + Intergenic
1182010088 22:26993512-26993534 AGCTGCTGTTGGCCTGGGCATGG + Intergenic
1182345904 22:29664665-29664687 GGCTACTGTAGTCGAGGGCATGG - Intronic
1182549096 22:31091427-31091449 GGCCTGTGGAGGCCTGGCCACGG - Exonic
1182567351 22:31210324-31210346 GGGTAGAGAAAGCCTGGGCAGGG - Intergenic
1182899612 22:33886980-33887002 GGCAAGTTTTGGTCTGGGCAAGG + Intronic
1183613259 22:38925605-38925627 GGCATGAGTAGGCCTGGGCACGG - Intergenic
1184089224 22:42283671-42283693 GGCCAGGGCAGGGCTGGGCAGGG - Intronic
1184730339 22:46368146-46368168 AGCTAGTGCAGCCATGGGCATGG - Intronic
949891160 3:8734495-8734517 AGCTAGGGGAGGGCTGGGCATGG - Intronic
950712684 3:14824228-14824250 GGCTGGAGCAGGTCTGGGCAAGG + Intronic
951630673 3:24716639-24716661 GGAGAGTGTTGGCCAGGGCAAGG + Intergenic
954989221 3:54824780-54824802 GGGTAGTGTTGGCCATGGCAGGG + Intronic
957775222 3:84750383-84750405 GTATAGTGAAGGCCTAGGCAAGG + Intergenic
959715997 3:109433149-109433171 GGCTAGTTTAAGCCTGGGGGAGG - Intergenic
959785339 3:110290934-110290956 GGCTACTGTGGAGCTGGGCATGG + Intergenic
960043419 3:113173299-113173321 GGCCAGAGCAGGCCGGGGCAGGG + Intergenic
960362729 3:116734210-116734232 GGCTATTGTAGGGCCAGGCACGG - Intronic
961110334 3:124278152-124278174 GGATAGTGTAGGGCAGTGCAGGG + Intronic
961652383 3:128422962-128422984 GGTTGGTGTGGGCCTGGGAAAGG - Intergenic
968078300 3:195829303-195829325 GGCTACTGTAGGGCTTGGCAGGG - Intergenic
968963777 4:3759174-3759196 GGCTTGTACAGGCCTGGGCTGGG - Intergenic
969946404 4:10787853-10787875 GTCTAGTGTTGGGCTGGGCATGG + Intergenic
970823495 4:20247779-20247801 GGATACTGTAGGTCTGAGCAGGG + Intergenic
972131101 4:35834315-35834337 ACCTAGTGAAGGGCTGGGCATGG - Intergenic
973970673 4:56211331-56211353 GGCCAAGCTAGGCCTGGGCAGGG - Intronic
977551607 4:98449113-98449135 GGTGAGTGCAGGCTTGGGCATGG - Intergenic
978524450 4:109651373-109651395 GGCTATTCTAGGGCTGGGCATGG - Intronic
982262309 4:153505394-153505416 GGCAAGTTGAGGGCTGGGCAAGG - Intronic
986963621 5:13244454-13244476 GGCTGGGGGAGGCTTGGGCATGG - Intergenic
988493338 5:31723906-31723928 GGCAAGTTGAGGGCTGGGCACGG - Intronic
988518187 5:31922969-31922991 GGCTAGTGAAGAGCTGGGCGTGG - Intronic
989606344 5:43247616-43247638 GTCTAGAGTGGGACTGGGCATGG + Intronic
992133786 5:73721726-73721748 AGCTAGTTTAGGGCTGGGCATGG - Intronic
992189741 5:74280190-74280212 GGTTAGTGGAGACCTGTGCATGG - Intergenic
997370273 5:133355365-133355387 GTCTAGTTTTGGGCTGGGCATGG + Intronic
998426972 5:142037018-142037040 GCCTAGTGGGGGCCCGGGCATGG + Intergenic
999080454 5:148838527-148838549 GACTATTCTTGGCCTGGGCAAGG + Intergenic
1000068513 5:157718030-157718052 GGTAAGTGGAGGGCTGGGCATGG - Intergenic
1002429809 5:179196581-179196603 GGCTAGTGTGGGGGTGGGCTGGG + Intronic
1002452999 5:179330360-179330382 GGCTGGTCCAGGACTGGGCATGG - Intronic
1003946029 6:11076776-11076798 GGCTAATGAAGTCCTGGGCAAGG - Intergenic
1004970450 6:20904243-20904265 GTCTAGTCCAGGGCTGGGCATGG + Intronic
1005798262 6:29391098-29391120 GGCTATGGTAGGCAGGGGCAGGG + Intronic
1006781389 6:36634775-36634797 AACTGGTGTAGGCCGGGGCACGG - Intergenic
1007729980 6:43939760-43939782 CGCTAGGGGAGGCCTGAGCAGGG + Intergenic
1010877085 6:81120337-81120359 GGCTAGTGTAGGCTAGAGCTGGG + Intergenic
1015999611 6:139029372-139029394 GGCTCGTGGAGCCCGGGGCAGGG + Intronic
1017280252 6:152616281-152616303 AGCTAGTGTTGGGCCGGGCACGG + Intronic
1019552008 7:1607874-1607896 GGCAAGGGTTGGGCTGGGCAGGG + Intergenic
1019730714 7:2627896-2627918 ATCTAGTGTGGGCCAGGGCATGG - Intergenic
1019742368 7:2681180-2681202 GGCTAGCGTGCGCCTGGCCATGG + Intronic
1022096691 7:27145644-27145666 GGCGAGTAGATGCCTGGGCAGGG - Exonic
1022220796 7:28311716-28311738 GGCCGGTGTACTCCTGGGCAAGG + Intronic
1023965675 7:44962090-44962112 GGCTGGGGTAGGCCTGGAGATGG + Intergenic
1024599294 7:50965272-50965294 GCATAGTATAGGCATGGGCAAGG + Intergenic
1025017263 7:55449468-55449490 GCGTAGTGCAGGCCTGGGCCTGG - Intronic
1025605646 7:63038284-63038306 AGCTAGTGCAGGGCTGGGGAGGG + Intergenic
1028449225 7:90962194-90962216 ATCTAGTGTGGGGCTGGGCATGG + Intronic
1031134817 7:117873285-117873307 GGCTAGTGTAGACGCGGGCCGGG - Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1036779309 8:11634700-11634722 AGCTAGTGCAGGGCTGGGGAGGG - Intergenic
1037797450 8:22008423-22008445 GGCTAGGGTTGGCCTGGACAGGG - Intergenic
1039250565 8:35659872-35659894 GGGTAGTGGTGGCCTGGGGAAGG - Intronic
1042663374 8:71179958-71179980 GGCTAGTGTAAGCCTGTTCTAGG + Intergenic
1048550047 8:135425729-135425751 TCATAGTGTAGGCCTGGGTAAGG + Intergenic
1051371071 9:16359762-16359784 GCCTGGTGTAGGCCTGAGCTGGG - Intergenic
1053318602 9:37075157-37075179 GGTAAATGAAGGCCTGGGCACGG - Intergenic
1053322748 9:37114859-37114881 GGTAAATGAAGGCCTGGGCATGG - Intergenic
1054272462 9:63044716-63044738 GGCTAGGGTAGCACAGGGCACGG + Intergenic
1054303596 9:63393735-63393757 GGCTAGGGTAGCACAGGGCACGG - Intergenic
1054402374 9:64720245-64720267 GGCTAGGGTAGCACAGGGCACGG - Intergenic
1054435977 9:65204560-65204582 GGCTAGGGTAGCACAGGGCACGG - Intergenic
1054494415 9:65817127-65817149 GGCTAGGGTAGCACAGGGCACGG + Intergenic
1056357143 9:85812363-85812385 GGTTACTGTAGCCTTGGGCAAGG - Intergenic
1056539522 9:87559308-87559330 GGCTAGGGTAGGGTAGGGCAGGG + Intronic
1056539524 9:87559313-87559335 GGGTAGGGTAGGGCAGGGCAGGG + Intronic
1056757399 9:89390406-89390428 GGCTACGGAAGGCCTGGGCAGGG + Intronic
1057584627 9:96318137-96318159 GGCTTCTGGAGGGCTGGGCATGG - Intergenic
1058998532 9:110323975-110323997 GGTTGGTGTAGGCCTGGAGATGG + Intronic
1060414647 9:123421778-123421800 GGCTCGTGGTGGCCTGGCCAAGG - Intronic
1060660191 9:125400888-125400910 GGGTACTGAAGGCCTGGGAAGGG + Intergenic
1060779856 9:126403386-126403408 GGCTACTATAGGCCTGGGGTGGG - Intronic
1060985444 9:127816712-127816734 GCCTGGTGTGGGCCTGGGCCTGG + Intronic
1061195065 9:129102976-129102998 GGCAGGTGTGGGGCTGGGCAGGG + Intronic
1061303250 9:129718367-129718389 GGCAGGTGTGGGCCAGGGCACGG - Intronic
1062030631 9:134360369-134360391 GGCAAGCCCAGGCCTGGGCACGG - Intronic
1062031215 9:134362867-134362889 GGCTGGTGCAGACCCGGGCATGG - Intronic
1062127245 9:134870349-134870371 GCCGAGTGTAGACCTGGGCATGG + Intergenic
1062460415 9:136660443-136660465 GTCTAGTCTTGGCCTGGGGAGGG + Intronic
1062690157 9:137837512-137837534 GGGGAGTGCAGGCCTGGGAAGGG + Intronic
1186310052 X:8308071-8308093 GGGTAGTGTAGGCCTGGGGGAGG + Intergenic
1186378567 X:9033671-9033693 GGCTGGGGTGGGCCAGGGCAGGG - Intronic
1186909073 X:14142252-14142274 AGCTATTGTAGGCCTTAGCATGG + Intergenic
1188063870 X:25633649-25633671 GGCTGTTGTAGGCAGGGGCAGGG - Intergenic
1192169055 X:68843218-68843240 GGCTAGTGTAGGGCTGGGCCTGG + Intergenic
1195736719 X:108019399-108019421 GGCTTTTGTATGCATGGGCAGGG + Intergenic
1195739314 X:108046503-108046525 GCCTAGTATGGGCCAGGGCAAGG - Intronic
1198790744 X:140342827-140342849 GATTACTGTGGGCCTGGGCATGG + Intergenic
1199671478 X:150151706-150151728 GGATAGTCTGGGCCAGGGCACGG - Intergenic
1200173877 X:154098079-154098101 GGCAAGTGAAGGCCTAGGCTTGG + Intergenic