ID: 911525368

View in Genome Browser
Species Human (GRCh38)
Location 1:98978349-98978371
Sequence ATGGAGAAGAAGATTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 942
Summary {0: 1, 1: 0, 2: 3, 3: 83, 4: 855}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911525368_911525372 3 Left 911525368 1:98978349-98978371 CCATCTTCAATCTTCTTCTCCAT 0: 1
1: 0
2: 3
3: 83
4: 855
Right 911525372 1:98978375-98978397 TGATGGTTCGATGTTGCATTGGG 0: 1
1: 0
2: 0
3: 2
4: 56
911525368_911525371 2 Left 911525368 1:98978349-98978371 CCATCTTCAATCTTCTTCTCCAT 0: 1
1: 0
2: 3
3: 83
4: 855
Right 911525371 1:98978374-98978396 ATGATGGTTCGATGTTGCATTGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911525368 Original CRISPR ATGGAGAAGAAGATTGAAGA TGG (reversed) Intronic
900861883 1:5239753-5239775 AGGGAAAAGAACATTGAAGGAGG - Intergenic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
902711024 1:18239795-18239817 ATGTGGAAGAAGATTGAAGGGGG - Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904816321 1:33203148-33203170 ATGGAGAATAAAATGGTAGATGG - Intergenic
905203703 1:36330671-36330693 ATGGAGGAGATGGTTGAGGAAGG - Intergenic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906370018 1:45245770-45245792 ATGGAGATGAAGATGGGAGTGGG + Intronic
906469155 1:46113099-46113121 GAGGAGAATAAGATTAAAGAAGG - Intronic
906504381 1:46367212-46367234 TTGGAGATGAAGAATGCAGATGG - Intergenic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
907709640 1:56867343-56867365 AGAGAGAAGAATATTAAAGAGGG - Intronic
907733877 1:57092960-57092982 ATTGAGAAGGCGATGGAAGAGGG + Intronic
908061919 1:60359719-60359741 CTGCAAAAGAAGGTTGAAGAAGG - Intergenic
908391416 1:63686913-63686935 ATGAAGAAGTGGATGGAAGAAGG - Intergenic
909031857 1:70550625-70550647 ATGGAAAAGAATATTCAAGAAGG + Intergenic
909399008 1:75205027-75205049 AAGGAGAATAAGAATGCAGAAGG + Exonic
909500122 1:76325147-76325169 ATGGAGAAGACCATAGGAGAAGG + Intronic
909597183 1:77419499-77419521 ATGGAAAAGAAGAAAGAAAAAGG + Intronic
910036288 1:82792798-82792820 ATAGAGAAAAAAATTGAATATGG + Intergenic
910259152 1:85279157-85279179 AGGGGAAAGAAGATGGAAGAGGG + Intergenic
911421137 1:97642133-97642155 ATGGAGAGGAAGAATCAATATGG + Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
911721647 1:101197619-101197641 GTGGAGAACTAGATTGGAGATGG - Intergenic
911967549 1:104386817-104386839 TTGGAGAGGAAGAGTGAAGGAGG - Intergenic
912037357 1:105334964-105334986 TTGGAGGAGAAGATTGATGATGG + Intergenic
912130853 1:106597981-106598003 ATGGATAAGAAGAATCAATATGG - Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912189062 1:107316408-107316430 ATGAAGTAGAAAATTCAAGATGG + Intronic
912915414 1:113810164-113810186 CTGGAGATGAAGCTTGAAGCAGG + Intronic
913153142 1:116065660-116065682 ATGGAGAAGGAGGTGGAAAAGGG - Intronic
913367271 1:118053884-118053906 ATTGGGAAGAAGCATGAAGATGG - Intronic
913643290 1:120832906-120832928 AAGGGGAAGAAGATCAAAGAAGG + Exonic
913643591 1:120835548-120835570 AAGGGGAAGAAGATCAAAGAAGG + Intronic
913644057 1:120839663-120839685 AAGGGGAAGAAGATCAAAGAAGG + Intronic
913705174 1:121413843-121413865 AAGGAGAAGAGGACTGTAGAAGG + Intergenic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
913984585 1:143553333-143553355 CTGGAGAAGCAAATAGAAGAAGG + Intergenic
914178131 1:145297194-145297216 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914178676 1:145301956-145301978 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914179052 1:145305125-145305147 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914179430 1:145308308-145308330 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914179974 1:145313064-145313086 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914180519 1:145317836-145317858 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914181062 1:145322598-145322620 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914181605 1:145327346-145327368 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914182150 1:145332113-145332135 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914182695 1:145336869-145336891 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914183240 1:145341619-145341641 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914183784 1:145346377-145346399 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914184328 1:145351149-145351171 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914184872 1:145355911-145355933 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914185417 1:145360658-145360680 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914185963 1:145365412-145365434 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914186509 1:145370172-145370194 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914187053 1:145374920-145374942 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914187596 1:145379672-145379694 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914188141 1:145384426-145384448 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914188684 1:145389176-145389198 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914269484 1:146067235-146067257 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914269839 1:146070379-146070401 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914270379 1:146075101-146075123 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914270916 1:146079837-146079859 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914271454 1:146084573-146084595 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914271989 1:146089294-146089316 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914272525 1:146094012-146094034 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914273063 1:146098734-146098756 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914273602 1:146103456-146103478 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914274140 1:146108174-146108196 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914274678 1:146112884-146112906 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914275211 1:146117602-146117624 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914275748 1:146122338-146122360 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914532317 1:148533916-148533938 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914532677 1:148537066-148537088 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914533212 1:148541786-148541808 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914533747 1:148546500-148546522 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914534283 1:148551208-148551230 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914534819 1:148555922-148555944 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914535354 1:148560639-148560661 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914535891 1:148565375-148565397 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914536426 1:148570097-148570119 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914536785 1:148573285-148573307 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914585331 1:149056567-149056589 AAGGGGAAGAAGATCAAAGAAGG - Exonic
914629134 1:149492057-149492079 AAGGGGAAGAAGATCAAAGAAGG + Intergenic
914629667 1:149496820-149496842 AAGGGGAAGAAGATCAAAGAAGG + Intergenic
914630202 1:149501575-149501597 AAGGGGAAGAAGATCAAAGAAGG + Intergenic
914630736 1:149506336-149506358 AAGGGGAAGAAGATCAAAGAAGG + Intergenic
914631267 1:149511097-149511119 AAGGGGAAGAAGATCAAAGAAGG + Intergenic
914631799 1:149515853-149515875 AAGGGGAAGAAGATCAAAGAAGG + Intergenic
914632336 1:149520606-149520628 AAGGGGAAGAAGATCAAAGAAGG + Intergenic
914632871 1:149525363-149525385 AAGGGGAAGAAGATCAAAGAAGG + Intergenic
914633406 1:149530092-149530114 AAGGGGAAGAAGATCAAAGAAGG + Intergenic
914633942 1:149534843-149534865 AAGGGGAAGAAGATCAAAGAAGG + Intergenic
914634477 1:149539594-149539616 AAGGGGAAGAAGATCAAAGAAGG + Intergenic
914635010 1:149544331-149544353 AAGGGGAAGAAGATCAAAGAAGG + Intergenic
914635545 1:149549068-149549090 AAGGGGAAGAAGATCAAAGAAGG + Intergenic
914636080 1:149553805-149553827 AAGGGGAAGAAGATCAAAGAAGG + Intergenic
914864459 1:151414910-151414932 ATACAGAAAAAGATTCAAGAGGG + Intronic
915889496 1:159759254-159759276 ATCGTGAAGAACATTGATGATGG + Intergenic
916176918 1:162049562-162049584 AGGGAGATAAAGATTGGAGAAGG + Intergenic
916635425 1:166662749-166662771 ATGGAGTAGAAGATGGAAGAAGG - Intergenic
916675423 1:167061219-167061241 ATGCATAAGAAGATCAAAGAAGG - Intronic
917225844 1:172781535-172781557 AGGAAAAAGAAGAATGAAGAAGG - Intergenic
917410661 1:174757010-174757032 ATGGACAAGAAGCTGGAGGAAGG - Intronic
917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG + Intronic
917534738 1:175866051-175866073 AAGGAGACAAACATTGAAGATGG - Intergenic
917535065 1:175868458-175868480 GTGGAGAAGAAAATGGATGATGG - Intergenic
917628233 1:176867308-176867330 AGGGAGAAGAAGAGGGGAGAGGG + Intronic
917687307 1:177430410-177430432 ATGGTGAATCAGATTGCAGAGGG - Intergenic
917725820 1:177826209-177826231 AAGGAGAAGAAACCTGAAGATGG - Intergenic
917965076 1:180173581-180173603 AGGGAGCAGAAGGTTGCAGATGG + Intronic
918256859 1:182756479-182756501 ATGGGGATAAAGAATGAAGATGG + Intergenic
918374487 1:183895439-183895461 AGGGAGAAGGAGATTGATGGAGG + Intronic
919071946 1:192766971-192766993 ATGGAAAAGGAGATTGTAGGGGG + Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919372248 1:196742300-196742322 AGGGAGATGAAGATTGAAGTGGG + Intronic
919811088 1:201409200-201409222 TTGGAGAAGAAGCATGAAGCAGG + Exonic
920610833 1:207436080-207436102 ATGCAGAAGAAGATTGAAACTGG + Intergenic
921183001 1:212646071-212646093 AGGGAGAAGAGGATTTGAGATGG + Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921648911 1:217653313-217653335 ATAGGAAAGAAAATTGAAGAGGG + Intronic
921719251 1:218452281-218452303 AGGGAGAAGAAGAATGGACACGG - Intergenic
921780788 1:219160856-219160878 ATTTAGAAGAAGAGTGAAGTAGG - Intergenic
923163151 1:231335659-231335681 GTGGAGAAAAGGTTTGAAGAAGG - Exonic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
924021199 1:239785543-239785565 ATGGAGAGGAAGACTGACGAGGG - Intronic
924107899 1:240667700-240667722 GTGAAGACGAAGAATGAAGAGGG - Intergenic
924145909 1:241074383-241074405 ATAGAGAAGGATACTGAAGAGGG + Intronic
924248351 1:242106866-242106888 ATGGAGAAGAAGAGTGTTGTAGG + Intronic
924490951 1:244536797-244536819 ATGGAGAAGAAGATTGGTGGAGG + Intronic
1062777514 10:165557-165579 ATGGAGACTAAGTTTGCAGAAGG - Intronic
1063327051 10:5114604-5114626 ATGGAGAAAAACATTAAAAATGG + Intronic
1063873992 10:10452512-10452534 GTGGGGAAGGAGGTTGAAGAGGG - Intergenic
1064335229 10:14434441-14434463 TGGGAGAAGAACATTGTAGAGGG - Intronic
1064720077 10:18220075-18220097 AAGGAGAAGAGGAATTAAGATGG - Intronic
1064941249 10:20738288-20738310 ATTGATGAGAAAATTGAAGAAGG - Intergenic
1065282727 10:24156115-24156137 ATGGAGAAAAACATTAAAAATGG - Intronic
1065322580 10:24522976-24522998 ATGGAGATGATTATTGAAAATGG + Intronic
1065488592 10:26258460-26258482 CTGGAGATGAATATTGATGATGG - Intronic
1065826422 10:29576238-29576260 ATTGAGAAGAAGAGTGCACAAGG - Intronic
1065857013 10:29839026-29839048 AGGGAGGAGAAGATTGCAAAAGG + Intergenic
1066087699 10:31987046-31987068 ATGGATAAGAAGAATCAATATGG + Intergenic
1066211511 10:33243899-33243921 AAGGAGAAGGAGAGTGGAGAAGG + Intronic
1066317016 10:34258260-34258282 GTGGAGAACAAGACTGGAGATGG + Intronic
1067023485 10:42822857-42822879 GTGGAAGAGAAGATCGAAGAGGG - Intronic
1067264524 10:44726859-44726881 TTGGAGAAGAACAAAGAAGAAGG - Intergenic
1068262333 10:54599010-54599032 ATGGATAGGAAGATTCAATATGG + Intronic
1068281399 10:54875332-54875354 ATGGGGAAGAAGAGAGAAGGAGG - Intronic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069578001 10:69544461-69544483 AGGAAGAAGAGGATTGAAAAGGG + Intergenic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1070906334 10:80076759-80076781 AAGGAGGAGAAGAATAAAGAGGG + Intergenic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071455960 10:85851881-85851903 AGGGAGAAAAAAATTGAGGATGG - Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071877817 10:89861504-89861526 AGGCAGAAGAAGAAAGAAGAAGG - Intergenic
1072747444 10:97950811-97950833 ATGGACAAGAAGATAGGACAAGG + Intronic
1072766560 10:98099234-98099256 AAGGAAAAGAAGATTGATGCAGG - Intergenic
1072851872 10:98904311-98904333 ATGAAGAATAACATGGAAGAAGG + Intronic
1073069042 10:100781849-100781871 ATGGAGAAGAAGAGGAGAGAGGG - Intronic
1073689160 10:105788127-105788149 AAGGAGAAGGAGATAGAAGAAGG - Intergenic
1074429063 10:113377860-113377882 ATTGAGATGAAGTCTGAAGAAGG + Intergenic
1075125214 10:119693965-119693987 AGGGAGAAGAAGGTAGAAGGGGG - Intergenic
1075848287 10:125564868-125564890 AAGGAGAGGAAGATTTAACAGGG - Intergenic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1079234060 11:18674900-18674922 CTGGGGAAGAAGGTTGCAGATGG - Intergenic
1079250627 11:18784795-18784817 ATGGAGAGGAAGATAGATCATGG - Intronic
1079645156 11:22853703-22853725 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1079645622 11:22860923-22860945 AGTGAGGAGAAGCTTGAAGATGG + Intergenic
1079666212 11:23109202-23109224 ATAGAGAAGGAGGTTGGAGATGG + Intergenic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1079944330 11:26722817-26722839 ATGGAGAAGGCCACTGAAGAAGG - Intronic
1080097584 11:28427540-28427562 ATGGATAAGAAGAATCAATATGG - Intergenic
1080233091 11:30039931-30039953 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1081023112 11:37971842-37971864 ATGGAGATGAAGGTGGAAGAGGG - Intergenic
1081858153 11:46316823-46316845 TTCCAGAAGAAGATAGAAGAGGG - Intronic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1084050057 11:66593505-66593527 ATGAAGAAGGTGCTTGAAGAGGG + Intronic
1084468452 11:69341066-69341088 ATGGAGAAGCACGTTGGAGAAGG + Intronic
1084469693 11:69351334-69351356 GAGGAAAAAAAGATTGAAGAAGG - Intronic
1084543837 11:69803818-69803840 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543875 11:69804053-69804075 ATGGATGAAAAGATGGAAGATGG + Intergenic
1085075871 11:73591504-73591526 ATGAATAAAAAGATTCAAGAGGG - Intronic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1086673554 11:89575751-89575773 ATGAAGTAGAAGAAAGAAGAAGG - Intergenic
1086942803 11:92815770-92815792 ATGGAGAGGAAGATGAAACATGG + Intronic
1087306867 11:96499361-96499383 CTGGAGAAGAAGAGAGAACAAGG - Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087859259 11:103133291-103133313 ACGGAAAGGAAGAATGAAGAAGG - Intronic
1087968211 11:104445953-104445975 ATCTAGAAGAAAATTGAGGAAGG - Intergenic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1088533595 11:110836860-110836882 TGGGATCAGAAGATTGAAGAAGG + Intergenic
1089900876 11:121983041-121983063 TTGGAGTATAAGATAGAAGAAGG + Intergenic
1089999024 11:122937720-122937742 ACGAAGGAGAAGAGTGAAGAGGG - Intronic
1090042697 11:123304556-123304578 ATGGAGGAGAAGGATGGAGAGGG + Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464631 11:126923312-126923334 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464639 11:126923369-126923391 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090568797 11:128025065-128025087 ATAAAGAAGAAGTTTTAAGAGGG + Intergenic
1091069371 11:132548832-132548854 ATGAAGCAGAGGGTTGAAGATGG - Intronic
1091366610 11:135026797-135026819 ATGGAGAAGAAGGTAGAGAAAGG - Intergenic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091669454 12:2442407-2442429 AGGGAGAAGAAGATGGAAATAGG + Intronic
1091855502 12:3736139-3736161 ATGGGGAAGAAGATGGAAGGAGG + Intronic
1092037089 12:5345567-5345589 ATGGAAAAGAACATTCAGGAAGG - Intergenic
1092233323 12:6790044-6790066 GAGGAGAAAAAGAGTGAAGAAGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092360583 12:7833036-7833058 GTGGAAAAGAAAATTGGAGAAGG + Intronic
1092875095 12:12840985-12841007 ATGGTGAAGAAAATTGAAACCGG - Intergenic
1093291743 12:17333226-17333248 ATGGAGAATAAGTTAGAAGGTGG - Intergenic
1093480225 12:19596774-19596796 ATTGATAAGAATAATGAAGAGGG + Intronic
1093813203 12:23511963-23511985 ATGAACAAGGAGGTTGAAGAAGG - Intergenic
1093844509 12:23952137-23952159 ATAGAGAAAAAAAGTGAAGAAGG + Intergenic
1094188001 12:27665359-27665381 ATAGAGGAGGAGAGTGAAGAAGG + Intronic
1094323672 12:29213058-29213080 ATGGGAAGGAAGTTTGAAGAAGG - Intronic
1095421915 12:42032868-42032890 ATGTACTAGAATATTGAAGATGG - Intergenic
1095529409 12:43168295-43168317 TTGGAGCAGAAGATTGCAGATGG - Intergenic
1096038745 12:48495527-48495549 ATGGAGCAGGAGAGTGAAAAGGG - Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096311484 12:50525045-50525067 ATGGAGAAAAAGCATCAAGAGGG + Intronic
1096360503 12:50981806-50981828 AAGGAAAAAAAGATGGAAGAGGG + Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096923516 12:55115915-55115937 ATGAAGAAGAGGATTGCAGATGG - Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097409630 12:59235457-59235479 ATGGAGAGGTAGGGTGAAGAGGG - Intergenic
1098424667 12:70347996-70348018 ATGAAAAAGAAAATTGTAGAAGG - Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1100097386 12:91057966-91057988 AGGAAGAAGAAGATCCAAGAAGG - Exonic
1100349706 12:93768370-93768392 ATAGAGAAGAAGATGGATTATGG + Intronic
1100855504 12:98753935-98753957 ATGGAGAGGAAGATGCAGGATGG + Intronic
1100868848 12:98888826-98888848 ATGGAGAAGATCATTTCAGATGG - Intronic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101736365 12:107466273-107466295 ATGGAGCAGAGGTTAGAAGAGGG + Intronic
1101794110 12:107957040-107957062 AATGAGAAGAAGAAAGAAGAAGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102411365 12:112722473-112722495 ATGAAGAAGTAGACTGAATATGG - Intronic
1102709091 12:114909620-114909642 CTGGCGAAAAAGATGGAAGAAGG - Intergenic
1102709137 12:114909952-114909974 AAAGAGAAGAAGATGGGAGAGGG - Intergenic
1102754701 12:115328044-115328066 ATGTGGAAGAAAATTGAGGAAGG - Intergenic
1102844270 12:116161842-116161864 ATAGTGAAGAAGCTTGATGAGGG - Intronic
1102848813 12:116218627-116218649 TTGGAGAAGAAATTTGAAAATGG - Intronic
1102872726 12:116426624-116426646 CTGGAGAGAAAGATTGGAGAAGG + Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103192789 12:119016641-119016663 ATGGAGGAGAATATGGAACAGGG - Intronic
1104738944 12:131158589-131158611 ATAGAGAAGAGGAAGGAAGAAGG - Intergenic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1106979919 13:35267107-35267129 GTGGAGGAGAAGAAAGAAGAGGG + Intronic
1107071427 13:36274041-36274063 ATAGAGAAGGAGAATGAAGTGGG - Intronic
1107390238 13:39955952-39955974 ATTGAAAAGAAAATTTAAGAAGG + Intergenic
1108192026 13:47951353-47951375 ATAGAGTAGAAGATTAGAGAGGG - Intronic
1108265462 13:48702734-48702756 TTGAAAAAGAAGATTGAAGTGGG - Intronic
1108265829 13:48707710-48707732 ATAGAGCAGAGGATTGAAGCAGG - Exonic
1109759177 13:66804471-66804493 ATAGAGAGGAAGATTGTAAAGGG + Intronic
1109838336 13:67888016-67888038 ATAGAGAACAACTTTGAAGATGG + Intergenic
1110355062 13:74558085-74558107 ATGGAGATCAAGGGTGAAGAGGG - Intergenic
1110496896 13:76178469-76178491 GTGGAGAGAAAGAGTGAAGACGG + Intergenic
1110666482 13:78123588-78123610 GTGGAGAAGAATGGTGAAGAAGG + Intergenic
1110694685 13:78474311-78474333 AAGGAAAAGAAGAGTGAAAATGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111276200 13:85950632-85950654 AAGGAGGAGAAGAATGAAGCTGG - Intergenic
1111698844 13:91660807-91660829 AAGGAGGAGAAGGTTTAAGAAGG - Intronic
1112030474 13:95451895-95451917 TTGGACAAGAAGGTTGAAGTTGG - Intronic
1112239357 13:97665669-97665691 CTGGAGAACAAGAGTGAAGAGGG + Intergenic
1112667327 13:101590576-101590598 ATTGAAAACCAGATTGAAGAGGG - Intronic
1112717286 13:102201670-102201692 AAGGTGAAGAAGATAGCAGAGGG + Intronic
1114068167 14:19084176-19084198 GTGGAAGAGAAGATTAAAGAGGG + Intergenic
1114094095 14:19315850-19315872 GTGGAAGAGAAGATTAAAGAGGG - Intergenic
1114413074 14:22518609-22518631 ATGGAGAAGAAGGTTAAAAAAGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115197884 14:30821507-30821529 ATCGTGAAGAACATTGATGATGG + Intergenic
1115450198 14:33539106-33539128 AGGGAGAAGAAGATTGTGTAGGG + Intronic
1115617848 14:35113298-35113320 ATGGAGAGGAAGAAGAAAGAAGG + Intronic
1116347566 14:43814410-43814432 ATGGATAAGAGGGTTGTAGAAGG + Intergenic
1116869926 14:50061085-50061107 AGGGAGAAGAGGCTGGAAGAGGG + Intergenic
1116926966 14:50649162-50649184 TTTGAGAAGAGGCTTGAAGAGGG - Intronic
1117774523 14:59169087-59169109 ATGAAGGAGAAGAATGAAGTTGG + Intergenic
1118905755 14:70022047-70022069 AAGGAGAAAAAGATTGATGTTGG - Intronic
1119042264 14:71285654-71285676 AAGGAGAAGGTGATTGAAGATGG - Intergenic
1119110533 14:71969614-71969636 AAGGAGGAAAAGAATGAAGAAGG - Intronic
1119676234 14:76557175-76557197 TTGCAGAAGAAAATTGAAGTGGG - Intergenic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1121295158 14:92814625-92814647 ATACAAAAGAAGTTTGAAGAAGG + Intronic
1121702900 14:95969484-95969506 ATTAACTAGAAGATTGAAGATGG - Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1121932905 14:97989559-97989581 AGACAGAAGAAGATGGAAGAAGG + Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122392799 14:101401846-101401868 ACGAAGAAGAAGAGGGAAGAGGG - Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1123424624 15:20159899-20159921 GTGGAAGAGAAGATCGAAGAGGG - Intergenic
1123533848 15:21166430-21166452 GTGGAAGAGAAGATCGAAGAGGG - Intergenic
1123871646 15:24581144-24581166 CTGGAGAAGAAGCTTGATGGTGG + Intergenic
1124395989 15:29302123-29302145 ATGAAGATGAAGAGTGAAAATGG - Intronic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1124956547 15:34364096-34364118 GAGGTGAAGAAGACTGAAGAAGG + Intronic
1125049738 15:35283085-35283107 AGGGAGAAGAAGAAGAAAGAAGG - Intronic
1125082111 15:35687033-35687055 ATGGAGAAGAGTTTGGAAGAGGG - Intergenic
1125146061 15:36470011-36470033 TTGAAGAAAAAGATTGAAAAGGG - Intergenic
1125354136 15:38799079-38799101 ATGGATAAGAAGAATCAATATGG - Intergenic
1125441384 15:39707531-39707553 ATGGAGGGCAACATTGAAGATGG - Intronic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127221479 15:56885695-56885717 AGGGGGAAGAAGATGGAAGGAGG - Intronic
1127524355 15:59777440-59777462 CTGGACAAAAAGATTTAAGATGG + Intergenic
1128095596 15:64952009-64952031 AAGAAAAAGAAGATAGAAGATGG - Intronic
1128095653 15:64952663-64952685 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1129991724 15:79970875-79970897 ATGGAAAAGGAGTTTGAAGACGG - Exonic
1130010696 15:80151456-80151478 AGGGAGAAGAGGCTGGAAGATGG - Intergenic
1130068122 15:80622806-80622828 ATGGATCAGAAGACTTAAGATGG + Intergenic
1130135740 15:81180389-81180411 AGGGAGGATAAGATTGCAGATGG - Intronic
1130838102 15:87671679-87671701 ATGGTGATGAGGATGGAAGATGG - Intergenic
1130895608 15:88168346-88168368 GGGGAGAAGAAGAGTGGAGATGG + Intronic
1131139818 15:89968096-89968118 AGGGAGAGGAAGAGAGAAGAAGG + Intergenic
1133876917 16:9743704-9743726 ATGTAGAAGAAGATGAGAGATGG + Intergenic
1134377401 16:13690307-13690329 CTGGGGAAGAAAATTGGAGACGG + Intergenic
1134776453 16:16857891-16857913 ATGAAAAACAATATTGAAGAGGG + Intergenic
1135741517 16:24979516-24979538 ATGGAGAGGAAATTTGAAGGAGG - Intronic
1135785051 16:25341094-25341116 AAGGAGAAGATGATTTCAGATGG + Intergenic
1135833767 16:25804287-25804309 ATGCAGAAGAAAAATGAAAAAGG - Intronic
1135912476 16:26573992-26574014 AGGGAGATTGAGATTGAAGATGG + Intergenic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1136860229 16:33695847-33695869 GTGGAAGAGAAGATCGAAGAGGG + Intergenic
1137625036 16:49902273-49902295 ATGGAGAAGAATGTTGTAGATGG + Intergenic
1138086523 16:54138887-54138909 ATGGAGAAGAAGATGTCAGTTGG - Intergenic
1138649280 16:58449653-58449675 ATGAAGAATGAGATGGAAGAAGG + Intergenic
1139165570 16:64561397-64561419 AAGGAGAAGAAGAAAGAAGGAGG + Intergenic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1140681560 16:77390297-77390319 GTGGAGAAGAAAATTTAAGGAGG + Intronic
1140991514 16:80217304-80217326 AGGGAGAAGATGAGTGAACAAGG - Intergenic
1141261714 16:82460257-82460279 ATGGGGAAGAACATTGCAGCAGG - Intergenic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1203121735 16_KI270728v1_random:1544015-1544037 GTGGAAGAGAAGATCGAAGAGGG + Intergenic
1142493089 17:291080-291102 GTGGAGATGAACACTGAAGATGG + Intronic
1142856315 17:2732293-2732315 AAGGGGAAGGAGATTAAAGAGGG - Intergenic
1142923299 17:3210141-3210163 ATGGAAAAGAAAAAAGAAGACGG - Intergenic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143296142 17:5873419-5873441 ATGGAACAGAAGAAGGAAGAAGG - Intronic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143474173 17:7193441-7193463 ATGGAGGAGAAGGTGGAAGTGGG - Intronic
1143656944 17:8300443-8300465 AGGAAGAAGAAGAAAGAAGAAGG - Intergenic
1146087208 17:29840588-29840610 ATGGTGAAGAAAATGGAAGATGG + Intronic
1146202319 17:30869826-30869848 ATAGAGATAAATATTGAAGAAGG - Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1149183827 17:53973763-53973785 ATGGAAAAGGAGAGAGAAGAGGG - Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150140437 17:62724056-62724078 AAGGAGAAGGATATGGAAGACGG + Intronic
1150604439 17:66678876-66678898 AGGGAAAAGAAGATTGCAGTGGG - Intronic
1151092812 17:71462019-71462041 ATGGTGATGAAGATTTATGAAGG + Intergenic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152198471 17:78931274-78931296 ATAGAGAACAAGAATGCAGATGG + Intergenic
1153144713 18:2018266-2018288 AAGGAGAAGAAGATCAAAGAAGG - Intergenic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153689348 18:7575946-7575968 GTGGAGAATCTGATTGAAGATGG + Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154059572 18:11047070-11047092 ATGGAAAGGATGAGTGAAGACGG - Intronic
1154261236 18:12834802-12834824 ATGGAGAAGAACAGTACAGAGGG + Intronic
1155176390 18:23304913-23304935 GTGAATAAGAAGACTGAAGAAGG - Intronic
1155235998 18:23819878-23819900 ATGAAGTATGAGATTGAAGACGG + Exonic
1155343708 18:24838118-24838140 ATGGAGAGGAAGAGAGAAGGTGG + Intergenic
1155724285 18:29060228-29060250 ATGGAGAAGAAACTTGGAGAAGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156020751 18:32597197-32597219 ATAGAGAAGAAAATAGCAGATGG + Intergenic
1156548634 18:37991113-37991135 AAGGAGAAGAAGATAGAATAGGG + Intergenic
1156922505 18:42539958-42539980 ATGGACAAAAAGCTTGAACAGGG + Intergenic
1156934921 18:42691984-42692006 GTGTAGTAGAAGATTGAAAAAGG + Intergenic
1157229898 18:45906022-45906044 ATTAAGAAGAGGACTGAAGATGG - Intronic
1157456263 18:47831311-47831333 ATGGAGAAGACCTTTGAAGAAGG - Exonic
1157511201 18:48276188-48276210 AATGAGAAGAGGAATGAAGAGGG - Intronic
1157633842 18:49129684-49129706 ATGGAGCAGGCGACTGAAGAGGG + Intronic
1158100405 18:53823423-53823445 ATGGAGAGGAAGAATCAATATGG + Intergenic
1158112532 18:53956738-53956760 ATGGAGATCAACAGTGAAGAAGG + Intergenic
1158280413 18:55819393-55819415 ATGGAGAAGGAGACCAAAGAGGG + Intergenic
1158317943 18:56232175-56232197 AAGGAAAAGAAGAGAGAAGAAGG + Intergenic
1158848586 18:61470858-61470880 AAAGAGGAGAAGATAGAAGAAGG - Intronic
1159247335 18:65824739-65824761 ATGGAGTACAAGATTGTGGATGG + Exonic
1159375921 18:67592856-67592878 ATGCAGAAGAAGAATATAGAAGG - Intergenic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160925352 19:1542229-1542251 AGGGAGAAGAAGGAAGAAGAAGG - Intergenic
1162639094 19:11993714-11993736 ATGGAGATCAAGAGTGAAGAGGG + Intergenic
1162717110 19:12641165-12641187 ATGAAGAAGAACATTCAAGATGG + Intergenic
1163387239 19:17007372-17007394 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1164431648 19:28194113-28194135 GAGGGGAAGAAGATTGGAGAGGG + Intergenic
1164918321 19:32069889-32069911 GTGGAGAAAAAGATTGGGGAGGG - Intergenic
1165834256 19:38744593-38744615 ATGGAGAAGAAACATGAAGGCGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166158828 19:40936342-40936364 TTGCAGAAGAAGTTGGAAGAAGG - Intergenic
1166167765 19:41004247-41004269 TTGTAGAAGAAGTTGGAAGAAGG - Intronic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1166774946 19:45306787-45306809 ATGGAGAAGAAGTTGGAGAAAGG - Exonic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
924980256 2:213169-213191 CTGAAGAAGAAGTTTGAAGCTGG - Intergenic
925263884 2:2551031-2551053 CTGGGGAAGAAGTTTGCAGAGGG - Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
926271108 2:11366716-11366738 ATGGAAAAAAACATGGAAGAGGG - Intergenic
926664517 2:15505891-15505913 CTGGACAAGAAGAGTGAAAAAGG + Intronic
926841430 2:17084950-17084972 ATGGAGAAGTAGATGGGAGATGG - Intergenic
926916460 2:17896697-17896719 AGGGAGAAGAAGCTGGCAGAAGG - Intronic
927028581 2:19096406-19096428 AGGAAGAAGAAGGTGGAAGAAGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927440236 2:23110584-23110606 ATGGATAGGAAGAATGAAAATGG - Intergenic
928171798 2:29009212-29009234 ATGGAGATGGAGGTGGAAGAGGG + Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928541227 2:32285425-32285447 AGGGATAAAAAGACTGAAGAAGG - Intronic
928635616 2:33242969-33242991 CTGGAAAAGAAGATTCAGGAAGG - Intronic
928696030 2:33851179-33851201 ATGGAAAAACTGATTGAAGAAGG + Intergenic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929829909 2:45338755-45338777 AGGGAGAAGAATATTTAATAAGG + Intergenic
929872141 2:45768106-45768128 ATGGAGAAGAAACTCTAAGATGG + Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930270982 2:49256499-49256521 ATGGAGAAGAAGCTGGAATGAGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930878779 2:56248805-56248827 ATGGTGAGGAAGCCTGAAGAGGG + Intronic
931560106 2:63551895-63551917 TAGGATAAGAAGATTTAAGAAGG - Intronic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933135772 2:78733246-78733268 ATGGAAAAAAAGTTTGAAGCAGG - Intergenic
933335377 2:80951226-80951248 ATGGAGATGAAAAATGAAGCTGG - Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934458595 2:94196961-94196983 GTGGGAGAGAAGATTGAAGAGGG + Intergenic
934535321 2:95128600-95128622 AGGGAGAAGAAGAAAGAAAAAGG + Intronic
934535326 2:95128629-95128651 AGGGAGAAGAAGAAAGAAAAAGG + Intronic
934579906 2:95429701-95429723 AGGGAGAAGTAGATGGGAGAAGG - Intergenic
934599541 2:95647024-95647046 AGGGAGAAGTAGATGGGAGAAGG + Intergenic
934910486 2:98249403-98249425 TTGGAAAAAAAGATTGAAGGAGG + Intronic
935660221 2:105460464-105460486 ATGGAGAAGAAAAATGTAGGAGG + Intergenic
935711003 2:105898293-105898315 CTGGTGAAGAAGATTGAAACTGG - Intergenic
935897721 2:107755637-107755659 CTGGCCAAGAAGATGGAAGAAGG - Intergenic
935941639 2:108245081-108245103 ATGGAGAAGAAAACAGTAGAGGG + Intergenic
936311775 2:111392134-111392156 AAGGAGAAGAGGATGGAAGGAGG + Intergenic
936523040 2:113224030-113224052 ATGGAGGAATAGATTGAAAAGGG + Intronic
936532880 2:113289032-113289054 AGGGAGAAGTAGATGGGAGAAGG + Intergenic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
937180690 2:119993516-119993538 ATTGTGAAGAACATTGATGATGG - Intergenic
937327125 2:120996723-120996745 ACGAAGAAGAAGAAAGAAGAAGG - Intergenic
937453908 2:122025122-122025144 AAGGAGAAGAAGGTGGAAGATGG + Intergenic
937814047 2:126231620-126231642 ATGGAGGAGGAGATGGAAGGAGG - Intergenic
939078437 2:137630425-137630447 ATGGGGAAGAAGTTTGGGGATGG - Intronic
939123919 2:138152304-138152326 AGGGGGAAGAAGAAAGAAGAAGG - Intergenic
939450457 2:142367069-142367091 ATGGATGAGAAGCTGGAAGAGGG + Intergenic
939669455 2:144992399-144992421 ATGGAGAACAAATTTCAAGAAGG - Intergenic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
941281920 2:163562552-163562574 AAGGAGAGGAACATTGGAGAAGG + Intergenic
941649199 2:168075134-168075156 ATGGATGAGAAGAGCGAAGAAGG - Exonic
941916540 2:170817243-170817265 AGGGATAAGAAGAGTGACGAGGG - Intronic
942017771 2:171833748-171833770 AGGGAGAAGAAGATGGAGGGAGG - Intronic
942248621 2:174029174-174029196 CTGCAGAAGGTGATTGAAGAGGG + Intergenic
942310340 2:174650572-174650594 ATGGAGAAGAACAGTCAGGATGG - Intronic
942572536 2:177328428-177328450 ATGGAGAAGGTAATTGGAGATGG + Intronic
942651869 2:178177544-178177566 ATGGAGAAGAATATATGAGATGG + Intergenic
942898421 2:181086154-181086176 TTGGATAAGAAGTATGAAGAAGG + Intergenic
942964883 2:181880044-181880066 AAGGAGAATAAGGTAGAAGAAGG - Intergenic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
943236853 2:185332753-185332775 GTGGAAAAGTAGACTGAAGAAGG + Intergenic
943439393 2:187907815-187907837 AAGGATAAGAAGATAGTAGAAGG + Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943986942 2:194635109-194635131 ATGGTAAAAAAGATTGAAGATGG - Intergenic
944916146 2:204362669-204362691 ATGGAGACAAAGTTTGAATAAGG + Intergenic
945487412 2:210413331-210413353 ATGCAGAAGACGATTGAAACTGG - Intergenic
945633507 2:212316457-212316479 AGGCTGAAGAAGATTGATGATGG - Intronic
945869053 2:215207166-215207188 GTGTAGAAGGAGATTAAAGATGG - Intergenic
946141778 2:217697363-217697385 AGGGAGAAGAAAAGAGAAGATGG - Intronic
946326871 2:218989159-218989181 AGGGAAAGGAAGAGTGAAGAGGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946738436 2:222777411-222777433 AAGGAGAAGAACATTCTAGAAGG + Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
948531257 2:238607045-238607067 ATGGTTGAGAAAATTGAAGATGG + Intergenic
948617010 2:239205662-239205684 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
948743032 2:240060661-240060683 ATGGAAAAACTGATTGAAGAAGG - Intergenic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169047120 20:2542278-2542300 GTGGAGAAGAAGCTTGACAAAGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171938916 20:31305231-31305253 TGGGAGAAGAAGATTGCAAAGGG + Intronic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172176297 20:32974123-32974145 ATAGACAAGAAGCTGGAAGAAGG + Intergenic
1172197997 20:33105221-33105243 ATGGAGAAAAAGAGTTTAGAAGG - Intronic
1172199958 20:33118436-33118458 CTGGAGAAGAGGAGTGAAGCAGG + Intergenic
1172950524 20:38720489-38720511 AGGGAGATGGAGATGGAAGAGGG - Intergenic
1173291383 20:41717996-41718018 ATGGCAAGGAAGATTGAAGCTGG - Intergenic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1173764269 20:45592883-45592905 ATGAACAAGAAAATGGAAGAAGG - Intergenic
1173856663 20:46254670-46254692 ATTGAGAAGAAAAGTAAAGAAGG + Intronic
1173906187 20:46631553-46631575 TTGGAGAGCAAGATTGAAGGAGG - Intronic
1174138136 20:48394554-48394576 ATAAAAAACAAGATTGAAGAGGG + Intergenic
1174283280 20:49454598-49454620 GTGGAGAAAAAGAATGAAGCAGG + Intronic
1175577461 20:60071832-60071854 ATGAAGAGGAACATTGACGAAGG - Exonic
1176940917 21:14924629-14924651 CTAGAGAAGAATATTGAAGTTGG + Intergenic
1177043389 21:16140767-16140789 AGGAAGAAGAAGATTGCAGGGGG - Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177484019 21:21731844-21731866 ATGGAAGACAAGGTTGAAGAAGG + Intergenic
1177581804 21:23033108-23033130 ATGGTGCAGAAGATTGAAGTTGG - Intergenic
1177755172 21:25337800-25337822 ATAGATAAGAAGACTGGAGAAGG + Intergenic
1177759098 21:25382601-25382623 ATGATGAAGAAGATTGATGGTGG - Intergenic
1177923126 21:27179198-27179220 ATGGAAAAGAACCTTGAACATGG - Intergenic
1178921973 21:36744701-36744723 ATGGCAAAGAAGATGGATGAAGG - Intronic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180486640 22:15806740-15806762 GTGGAAAAGAAGATTAAAGAGGG + Intergenic
1180658152 22:17442115-17442137 ATTCAGAAGAAGATTCAAGGTGG + Intronic
1180685490 22:17663169-17663191 ATGGATAAGAACATTTAAGAAGG - Intronic
1181357608 22:22309471-22309493 GTGGAAGAGAAGATCGAAGAGGG - Intergenic
1181442816 22:22945702-22945724 ATGGAAAATAATATTAAAGAGGG - Intergenic
1181538078 22:23557135-23557157 ATGCAGAAGGAGTTTCAAGAAGG + Intergenic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1182867046 22:33612916-33612938 AGGCAGAAGAAGATTGAAGGAGG - Intronic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183356155 22:37360851-37360873 ATGGAGATGAAGAACCAAGATGG + Intergenic
1183597360 22:38820727-38820749 AGGGGGAAGAACACTGAAGAGGG + Exonic
1183680407 22:39325417-39325439 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184277024 22:43414773-43414795 AGGGAGAAGAAGAATGGAAAGGG - Intronic
1184952452 22:47853625-47853647 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949264681 3:2142664-2142686 ATGGAGGGGAAGATTAAAAAGGG - Intronic
949690947 3:6638397-6638419 ATGGGGAAGAAAACAGAAGAAGG + Intergenic
949862380 3:8517897-8517919 ATGGAGAACAAAATTCATGAAGG + Intronic
950162578 3:10771473-10771495 CTGGATAAGAAGACTGAAGCTGG - Intergenic
951839676 3:27021156-27021178 ATGGTGAGGATGATAGAAGATGG + Intergenic
951974079 3:28483591-28483613 ATGGATAAGAAGACTCAATATGG - Intronic
952073072 3:29662717-29662739 ATGGAGAAGAAATCTGTAGAAGG - Intronic
952316234 3:32235068-32235090 ATGGAGAAGAAAATGGAAACAGG - Intergenic
952344475 3:32471027-32471049 AAGAAGAAGAAGATAGAAGAAGG + Intronic
953014193 3:39057034-39057056 GTGGAGAAAACCATTGAAGAAGG + Intronic
953065458 3:39465588-39465610 GTGGAGTAGAAGATCAAAGATGG + Intergenic
953501209 3:43436464-43436486 AAGGAGAAGAACAGTGAAGGTGG + Intronic
953677303 3:45013138-45013160 AGGTAGAAGAACATTGAAGTTGG + Intronic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955307444 3:57848500-57848522 AGGAAGAAGAAGAAAGAAGAAGG - Intronic
955342864 3:58138884-58138906 ATGGCCATGAAGATGGAAGAAGG - Intronic
956295190 3:67704650-67704672 AGGGAGAAGATGATTAAAGAAGG - Intergenic
956622426 3:71234741-71234763 GTGGATAAGATGATTGAAAATGG + Intronic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957640781 3:82850403-82850425 AGGGATAAGAAGAAAGAAGAAGG - Intergenic
957892285 3:86376128-86376150 AAGGGGAAGAAGATGAAAGAAGG - Intergenic
957949092 3:87101196-87101218 TTGCAGAAGAAGTTTTAAGAAGG + Intergenic
958585503 3:96081913-96081935 ATGGATAAGAAAATTGGAGAAGG + Intergenic
958621188 3:96563439-96563461 TTGGAGAAGATGCTTAAAGATGG - Intergenic
958804052 3:98788062-98788084 ATGAAGAAGAAGTTGGGAGAAGG + Exonic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960148384 3:114227300-114227322 GGGGAGAAGAGGGTTGAAGAGGG + Intergenic
960184603 3:114623494-114623516 ATGCAGAAGAATAAAGAAGAGGG + Intronic
960299031 3:115979171-115979193 ATGGGGAAGAAGAGCAAAGAGGG + Intronic
960314434 3:116159050-116159072 ATGGGGCAGAAGATTGAAACTGG + Intronic
960337046 3:116430425-116430447 ATGGAGTAGAAGATTGAAATGGG - Intronic
960399416 3:117177893-117177915 ATGGAGTGGAAGATGGCAGAGGG + Intergenic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
962193260 3:133333331-133333353 ATGGATAAGCAGAGTAAAGAAGG - Intronic
962458070 3:135583538-135583560 ACTGTGAAGAAGTTTGAAGAGGG + Intergenic
964580760 3:158234665-158234687 AGGGAGAAGAGGATTGGGGAGGG - Intronic
964815995 3:160718662-160718684 TTGAAGATGAAGATTAAAGATGG + Intergenic
965172168 3:165279838-165279860 GAGGAGAAGAAGAGAGAAGAAGG - Intergenic
965264904 3:166531061-166531083 AAGGAGAATTAGAGTGAAGAGGG + Intergenic
965476935 3:169167614-169167636 ATGGAGGAGGAGTTAGAAGATGG - Intronic
965951098 3:174309077-174309099 ATAGAGCAGAAGTGTGAAGATGG + Intergenic
966092245 3:176154239-176154261 AAGGAGGAAAAGAGTGAAGAAGG - Intergenic
966285492 3:178290240-178290262 ATAGAGAAAAGGATTGAAGAGGG + Intergenic
966306356 3:178540108-178540130 ATGGAGAAAAATATAGAAGGAGG - Intronic
966403636 3:179572126-179572148 CATGAGAAGAGGATTGAAGATGG + Intronic
966454514 3:180099989-180100011 AAAGAAAAGAAGATTGAATAAGG + Intergenic
966564320 3:181359467-181359489 ATGCTGAATAAGATTGAAGAGGG + Intergenic
966666135 3:182472993-182473015 TAGAAGAAGAAGACTGAAGAGGG - Intergenic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
967135206 3:186507288-186507310 ATGGAGAGGAAGAGTCAAGTGGG + Intergenic
967487832 3:190054863-190054885 ATGGAGAACAAGATGGAGGGGGG - Intronic
967741805 3:193011105-193011127 AGGGATAAGAATATTGAAGTTGG - Intergenic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969835439 4:9836437-9836459 GTGGAGATGTGGATTGAAGACGG + Intronic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970197736 4:13569206-13569228 ACAGAGAAGAGGAATGAAGAGGG + Exonic
970368835 4:15387947-15387969 AGGGAGAAGAGGAGAGAAGATGG + Intronic
971054514 4:22897493-22897515 ATAAAAAACAAGATTGAAGAGGG - Intergenic
971594190 4:28507960-28507982 AAGGAGAATAAGATTGAATAGGG + Intergenic
971642132 4:29147726-29147748 ATGGAGGAGAGGATTGGAGATGG - Intergenic
971783530 4:31070436-31070458 ATGGAGTAGAACATTCTAGAGGG - Intronic
972305026 4:37822703-37822725 ATAGAATAGTAGATTGAAGAAGG - Intergenic
972396052 4:38660802-38660824 ATGGTGAAGAGGAGGGAAGAGGG - Intergenic
972456087 4:39256797-39256819 ATGGAGAACAGGATGGATGAAGG - Intronic
972709663 4:41582312-41582334 ATGGAAAACTAGATGGAAGATGG + Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973555809 4:52081560-52081582 ATGGAGAATAAGAATAAAAAGGG - Intronic
973628989 4:52801500-52801522 ATGGACAAGAACATTGAGAATGG - Intergenic
973645640 4:52948859-52948881 AGGGAGAAGAAAATAGAAGGCGG - Intronic
973874112 4:55198229-55198251 ATGGATCAGAAGACTGAATATGG + Intergenic
973899199 4:55450430-55450452 AAAGAGAAGAAGAATGAAGTTGG + Intronic
973962683 4:56127522-56127544 AGGCAGAAGAAGAGAGAAGAAGG - Intergenic
974482013 4:62457241-62457263 ATGGTGAGGAAGATGAAAGAAGG + Intergenic
974519100 4:62957865-62957887 ATGGAGAAGCAGATTGCAAATGG + Intergenic
974543703 4:63272850-63272872 ATAGAGATGAAGATTAAATATGG - Intergenic
974994445 4:69136385-69136407 ATGGAAAAGTAAATTGTAGATGG + Intronic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975100647 4:70509080-70509102 ATGGAGAGGTAGCTTCAAGAGGG + Intergenic
975249583 4:72162990-72163012 ATGGATTAGAAGATTCAATATGG - Intergenic
976303789 4:83539641-83539663 ATGCAGAAGAAAATAGAAGTAGG - Intronic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976504087 4:85826277-85826299 ATGGAGAAGGGGATTAATGAAGG - Intronic
976927201 4:90514058-90514080 ATGGAGAAGAACATTTACAAAGG + Intronic
976965074 4:91027984-91028006 ATGGAAAAGAAAAAAGAAGAGGG + Intronic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
979025707 4:115571853-115571875 ATGGAGAAGAAGGATGTACATGG + Intergenic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979154047 4:117359623-117359645 ATGGAGAAGTAGCTTGAAACAGG + Intergenic
979156944 4:117406145-117406167 GTGGAGAAGAAAAATCAAGATGG + Intergenic
979340109 4:119512737-119512759 AGGGAGAAGATGATTAAAGATGG + Intronic
979564617 4:122140313-122140335 ATGGATAAGAAGAATCAATATGG - Intergenic
980387565 4:132106059-132106081 ATGAAGAAGAAGATTGATATTGG + Intergenic
980649351 4:135689947-135689969 ATGGAGAATAGGAGTGAAAAAGG + Intergenic
980971558 4:139572187-139572209 AAGAAGAAGAAGATGGAAGATGG - Intronic
981000940 4:139828659-139828681 ATGGAGACGAAGGTTGAAAATGG + Intronic
981125990 4:141106859-141106881 GTGGAAAAGAACATTGTAGATGG - Intronic
981179855 4:141728355-141728377 ATGGAAAATATGATTGCAGATGG - Intronic
981213140 4:142132246-142132268 GTAGAGAATAAGATTGGAGAAGG + Intronic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
983363039 4:166751072-166751094 ATGGAGAAGAAAAGTGATTAAGG - Intronic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
983707167 4:170675913-170675935 ATGGCTAAGAAGATTGTAGGAGG - Intergenic
983886084 4:172982158-172982180 ATGCAGAAAGAAATTGAAGAAGG - Intronic
984126036 4:175812205-175812227 ATGGAAGAGAATATGGAAGAGGG - Exonic
985212968 4:187614979-187615001 ATGGATTAGAAGACTCAAGATGG + Intergenic
985268346 4:188171207-188171229 ATAGAGATGATGACTGAAGAGGG + Intergenic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
986120776 5:4834386-4834408 ATGAAGAACAAAATTGAAAAAGG + Intergenic
986668692 5:10125172-10125194 AGGGGGAAGACGAGTGAAGAAGG + Intergenic
987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG + Intronic
988353794 5:30146035-30146057 ATTAAGAAGAAAATTGAAAAAGG - Intergenic
988632089 5:32942416-32942438 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
988641264 5:33042575-33042597 GTGGAGCAGAAGACTTAAGAAGG + Intergenic
988683761 5:33507870-33507892 ATGTAGAAGAAGAGAGAAGGAGG - Intergenic
989020686 5:37003297-37003319 TTGGAGAAGAATATTCAGGATGG + Exonic
989165501 5:38430068-38430090 ATCGTGAAGAACATTGATGATGG - Intronic
989633855 5:43513837-43513859 ATGAAGAAAAAACTTGAAGAGGG - Intronic
989973599 5:50555054-50555076 AGGGAGAAGAGGACTGTAGAAGG - Intergenic
991365722 5:65866067-65866089 ATGGGGAAGAAGACAGAAGAGGG + Intronic
992787523 5:80184241-80184263 ATGGAGTAGAAGAGAGAAGGTGG - Intronic
993271750 5:85806055-85806077 AGAGAGAAGAGGAATGAAGAGGG + Intergenic
993602819 5:89949746-89949768 GTTGAGAAGAAAATTCAAGAAGG + Intergenic
993778756 5:92038704-92038726 ATGGAGGAGAAGATTTAGGCAGG + Intergenic
994110765 5:96001357-96001379 CTGGGGAAGAAGAATCAAGAAGG + Intergenic
994437193 5:99752072-99752094 ATGAAGAAAGAAATTGAAGAGGG - Intergenic
994865302 5:105261122-105261144 AGAGAGAAGAAAATTGCAGAAGG + Intergenic
995646698 5:114320734-114320756 ATGGAGAAGAAGATACATGAAGG - Intergenic
995918705 5:117284142-117284164 CAGGAGAAGCAGATTGAACACGG - Intergenic
995963743 5:117878112-117878134 ATGGAGAAGAAGTTTTATGATGG + Intergenic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996794538 5:127330489-127330511 CTGGCAAAGGAGATTGAAGAGGG - Intronic
996857053 5:128020000-128020022 ATTGAGAATAACACTGAAGATGG - Intergenic
996890115 5:128408814-128408836 AAGGAGAAGATGATTGAGAAAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997289375 5:132715756-132715778 CTGAAAAAGAAGCTTGAAGAAGG - Exonic
997300576 5:132800885-132800907 ATGAAGACAAAGATTGGAGAAGG + Intronic
997343245 5:133163606-133163628 ATGGAGAAGAAGATAAAACTGGG - Intergenic
997944362 5:138186023-138186045 GTGGACAAGAAGTTAGAAGAGGG + Exonic
998878821 5:146626953-146626975 ATGGAAATGAGGATGGAAGAAGG + Intronic
999211030 5:149888711-149888733 ATGGATAAGAAAGTTGTAGAAGG + Intronic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999448194 5:151658334-151658356 TTGGATGAGAAGATTGAAAATGG - Intergenic
999642961 5:153690145-153690167 TTGGAGAGGAGGATTCAAGAAGG - Intronic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1000238911 5:159390698-159390720 ATGGAGAAGAACTATGAAGTGGG + Intergenic
1000378956 5:160611762-160611784 ATGGAGAAAACGAAAGAAGACGG - Intronic
1000446226 5:161325093-161325115 ATGATGAAAATGATTGAAGAAGG - Intronic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000783796 5:165517528-165517550 ATAGAGAAAAAGATAGAACACGG - Intergenic
1001210968 5:169809910-169809932 ATGGAGAAGAGGATTAGAGAAGG - Intronic
1001462628 5:171931058-171931080 ATGGAAAGGAAGATTCAATAAGG + Intronic
1001837904 5:174847486-174847508 AGGGAGAACAAGCTTGTAGACGG - Intergenic
1001853999 5:174995041-174995063 ATGGAGAATAAGTATAAAGATGG + Intergenic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1002770257 6:284254-284276 ATGGAGGAGGAGACTTAAGAGGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003631860 6:7794620-7794642 AAGGAGAAGAAGAATGTAAAGGG + Intronic
1003768167 6:9264592-9264614 TTGGAGAAAAAGATTGTATACGG + Intergenic
1003905668 6:10697444-10697466 ATGAAAAAGAAGATTGAGCATGG + Exonic
1003985956 6:11435652-11435674 AAGGAGGAGAAGATGGGAGAGGG - Intergenic
1004050912 6:12078058-12078080 ATGGTGAAGAAGAATGCATATGG + Intronic
1004264670 6:14138662-14138684 ATGGAGATGAAGAATAAATATGG - Intergenic
1004549403 6:16632164-16632186 TTGGGGAAGAAGAGTGAATAGGG - Intronic
1004804802 6:19191278-19191300 CTGGGAAAGAAGATTGAAGTCGG - Intergenic
1005740397 6:28785782-28785804 AAGGAAAAGAAGATGTAAGAAGG - Intergenic
1005887607 6:30108675-30108697 ATGGAAATGAAGATGGGAGATGG + Intronic
1006046122 6:31300211-31300233 ATGAAGAATAAGAGTGCAGACGG + Intronic
1006709136 6:36050278-36050300 AGGGAGATGAAGACAGAAGAGGG + Intronic
1006763959 6:36488413-36488435 ATGGAGAACAGGAGGGAAGATGG - Exonic
1007041055 6:38722810-38722832 ATGGAGAAGGATGCTGAAGATGG + Exonic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1007509758 6:42365975-42365997 ATGGGAAACAAGATTGAAGAAGG - Intronic
1008911987 6:56744347-56744369 ATGGAGAAAAACTTTGAAAAAGG + Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1009810853 6:68664495-68664517 ATGGCTAAGAACATGGAAGAGGG + Intronic
1009928496 6:70148581-70148603 ATGTAAAAGAACATTGGAGATGG + Intronic
1010408810 6:75537212-75537234 AGGGAGGATAAGTTTGAAGAAGG + Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010858046 6:80868161-80868183 AAGGAGAAGATGATTGACTATGG - Intergenic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1011018091 6:82781319-82781341 ATGAAGAAAATGATTAAAGATGG + Intergenic
1011146407 6:84222445-84222467 ATGTAGAATGAGATTGAAAAAGG - Intronic
1011837166 6:91446951-91446973 ATGGAAAAGAAGTTTAAAAAAGG + Intergenic
1011908486 6:92404241-92404263 CTGCAGAAGAAGTTTGAAGCTGG - Intergenic
1012145509 6:95675638-95675660 ATGGATAAGAGGATGAAAGAAGG - Intergenic
1013626964 6:111948148-111948170 TTGAAGAAGAACTTTGAAGACGG + Intergenic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1014044330 6:116866997-116867019 AAGGAGGAGCAGGTTGAAGAAGG - Intergenic
1014090898 6:117402451-117402473 TTGGAAATGAAGAGTGAAGAGGG - Intronic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015011655 6:128356587-128356609 ATTAATAAGAAAATTGAAGAGGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015288942 6:131516059-131516081 ACACAGAAGAAGATTGAAGTTGG - Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1016483913 6:144513557-144513579 AAAGAAAAAAAGATTGAAGAGGG + Intronic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1016794723 6:148105753-148105775 ATGGAGGAGAAGGAGGAAGATGG + Intergenic
1016910701 6:149195933-149195955 ATTGTTAAGAAGATTTAAGAAGG - Intergenic
1017081746 6:150676095-150676117 AAGGAGGAGAAAATTGAAAAGGG + Intronic
1017827075 6:158089566-158089588 ATTGAAAAAAAGATAGAAGATGG + Intronic
1018214566 6:161514446-161514468 ATGGGGAAAAAGGGTGAAGAAGG + Intronic
1018248336 6:161843297-161843319 ATGGAGAAGGAGACAGAAGGTGG - Intronic
1018833881 6:167468950-167468972 ATGGAGGCGAAGATTGAAAAAGG - Intergenic
1019484066 7:1280423-1280445 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1019555923 7:1631284-1631306 ATGTGGAAGAAGATAGAAGGAGG - Intergenic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020932343 7:14413582-14413604 AAGGAGAAGAAGCCTGAAGCGGG + Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1022088494 7:27092110-27092132 ATGGAGAAGAACTTCAAAGACGG - Intergenic
1022108832 7:27215376-27215398 AAGGAGGAGGAGAGTGAAGAAGG - Intergenic
1022651948 7:32285680-32285702 AGGGAGAAGAAGAAGAAAGAAGG + Intronic
1022684012 7:32577793-32577815 ATTGAAAAGAAGGCTGAAGAAGG + Intronic
1022892137 7:34712307-34712329 ATGGAAAAGTAGAGTGGAGAAGG - Intronic
1023108057 7:36782555-36782577 TTGGACAGGAACATTGAAGATGG + Intergenic
1024130506 7:46347868-46347890 ATAGAGAAGAAGATGGAAATTGG + Intergenic
1024157625 7:46640679-46640701 AAGGAGGAAAAGAGTGAAGAGGG + Intergenic
1024270160 7:47635850-47635872 AAGGAGAAGAGGAGTGAAGGAGG + Intergenic
1024763947 7:52633942-52633964 ATGAAGAAGAACAATTAAGAGGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026595127 7:71728195-71728217 TTGGGGAGGAAGATTGCAGAGGG - Intergenic
1026789764 7:73324075-73324097 AGGGAGAGGAAGAGGGAAGAGGG + Intronic
1026962791 7:74419745-74419767 GTGGAGTGCAAGATTGAAGATGG - Intergenic
1027644076 7:80774681-80774703 AGAGGGAAAAAGATTGAAGAAGG + Intronic
1028753525 7:94409478-94409500 GGGAAGAAGAAGAATGAAGATGG + Intronic
1028770324 7:94612792-94612814 AGAGAGAAGAAGATAGAAGGAGG - Intronic
1028775038 7:94666262-94666284 ATGGAAATGGAGTTTGAAGACGG - Exonic
1029448012 7:100625570-100625592 ATGGAGAAAGAGATATAAGAAGG + Intronic
1029815211 7:103086890-103086912 ATGGAGAATAAGACAGAAGAGGG + Intronic
1029961475 7:104692784-104692806 ATGGAGAAGGAAATTGCAGAAGG + Intronic
1030975433 7:116116203-116116225 ATGGAAAAGAAGAATAAAAATGG + Intronic
1031428930 7:121641842-121641864 ATGGAGAAGAGAATGGGAGAAGG - Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031790686 7:126099344-126099366 AAGTAGAAGAAGAATTAAGAAGG - Intergenic
1031801733 7:126255228-126255250 ATGATGAAAAAAATTGAAGAAGG + Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032359559 7:131242664-131242686 ATCGTGAAGAACATTGATGATGG + Intronic
1032559535 7:132874300-132874322 CTGGAGAATAAGTTTGATGATGG - Intronic
1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG + Intronic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1032801344 7:135319513-135319535 ATTCAGAAGATGTTTGAAGAAGG + Intergenic
1033895237 7:146061061-146061083 ATGGAGAAAGACAGTGAAGATGG + Intergenic
1034173165 7:149078926-149078948 GGGGAGAAGATGATAGAAGAGGG + Intronic
1035113017 7:156500228-156500250 ATTTGGAAGAAGATGGAAGAAGG + Intergenic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1035913620 8:3595932-3595954 AAAGAGAAGAAGATGGGAGAGGG - Intronic
1035917854 8:3644513-3644535 ATGGGGAAGATGATGAAAGAGGG + Intronic
1036592981 8:10185621-10185643 ATGGAGAAGAAAGTAGCAGATGG + Intronic
1036717081 8:11135718-11135740 AAGGAGAAAAAAATTAAAGAAGG + Intronic
1037077160 8:14734679-14734701 ATGTAGAGGAAGCTTGGAGAGGG - Intronic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037706628 8:21321038-21321060 ATGGACAGCAAGACTGAAGATGG - Intergenic
1038363813 8:26910282-26910304 ATGGAGTAGAAAATTACAGAAGG + Intergenic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039390855 8:37179866-37179888 AGAGAGAAGAAGAAAGAAGAGGG - Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1040412564 8:47169209-47169231 GTGGAGAAGAATATGGCAGAGGG - Intergenic
1040773168 8:51004257-51004279 ATGGAGAAGAATTTAGAAGTAGG + Intergenic
1040897540 8:52384436-52384458 ATGGAGAGGATGAGTGAAGTGGG - Intronic
1041060974 8:54034188-54034210 ATGGAGAAAAAAATTAAAGCAGG - Intergenic
1042093646 8:65188024-65188046 GGGGAGAGGAAGACTGAAGAGGG - Intergenic
1042193270 8:66209623-66209645 ATGGAGTAGAGGTTTGCAGATGG + Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042648107 8:71009655-71009677 ATGGGGAAGAAGAGTGCTGAGGG + Intergenic
1043024670 8:75050860-75050882 ATGTAGGACGAGATTGAAGAGGG - Intergenic
1043035964 8:75199689-75199711 CTGAAGAAGGAAATTGAAGAGGG - Intergenic
1043139692 8:76572814-76572836 AAGAACTAGAAGATTGAAGAAGG + Intergenic
1043457522 8:80427281-80427303 AAGGATAAAAATATTGAAGATGG - Intergenic
1043609210 8:82041460-82041482 TTGCAGAAGAAGCTTGAAGCTGG + Intergenic
1043632583 8:82354857-82354879 AAGGAGATGAATACTGAAGAAGG + Intergenic
1043859626 8:85300749-85300771 ATGGAGGAGGAGATGGAAAAGGG + Intergenic
1043945092 8:86241110-86241132 ATGGATAAGAAGAATGGATAAGG - Intronic
1044061059 8:87636346-87636368 GTGGAGCAGATGATTGAAAAAGG - Intergenic
1044068620 8:87727544-87727566 AGAGAGAAGAAGAATGAAGGAGG - Intergenic
1044288157 8:90435235-90435257 ATGGAGGGTAAGATTGGAGAAGG + Intergenic
1044414517 8:91921437-91921459 TTGGTGAAGAAGATTAAAGATGG + Intergenic
1045370147 8:101514913-101514935 AAGGAGAAGAAGAAAGAACAAGG - Intronic
1046481714 8:114828343-114828365 ATGCAGAAGAACACTCAAGAAGG + Intergenic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1046885217 8:119359597-119359619 ATGGAAAAGAAGAGGGAAAATGG - Intergenic
1047783933 8:128135427-128135449 CTGGAGAAGAAGTGTGATGAAGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048143452 8:131818351-131818373 AAGTAGAAGAAGATGGAAGTCGG - Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048200621 8:132371169-132371191 AAGGAGAGTCAGATTGAAGATGG - Intronic
1048833554 8:138497744-138497766 AGGGAGAGGAAGATTGGGGAGGG + Intergenic
1049929760 9:444995-445017 ATGAAGAAGATAATGGAAGAGGG + Intronic
1049968955 9:804478-804500 CCGGAGAAGAAAATTGAACAAGG - Intergenic
1050159651 9:2704260-2704282 ATGGAGAAGAAAAATAAATAAGG + Intergenic
1050264669 9:3877789-3877811 AAGGAGAAGAATATTGCAGGAGG - Intronic
1051581784 9:18684039-18684061 GTGGAGGAGAAAAATGAAGAGGG - Intronic
1051864458 9:21663795-21663817 AAGGATAAGAAGATAGCAGAGGG - Intergenic
1052054646 9:23890558-23890580 GTGGAGAAGAAAATGGAACAAGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052240559 9:26267735-26267757 ATGGGGAAGAAAACTGCAGATGG - Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052416752 9:28187574-28187596 ATGAAGAAGAAGACTGTAGGAGG + Intronic
1052929152 9:34042107-34042129 ATTGAGAATAAGACTGAAAATGG + Intronic
1053539047 9:38954685-38954707 CTGGAGAATAAGTTGGAAGAAGG + Intergenic
1053576294 9:39359268-39359290 CTGGGAAAGAAGATTGAAGATGG - Exonic
1053689094 9:40572777-40572799 GTGGAAGAGAAGATCGAAGAGGG + Intergenic
1053840805 9:42187193-42187215 CTGGGAAAGAAGACTGAAGATGG - Exonic
1054097863 9:60917959-60917981 CTGGGAAAGAAGATTGAAGATGG - Intergenic
1054119265 9:61193589-61193611 CTGGGAAAGAAGATTGAAGATGG - Exonic
1054274940 9:63058289-63058311 GTGGAAGAGAAGATCGAAGAGGG - Intergenic
1054300338 9:63373709-63373731 GTGGAAGAGAAGATCGAAGAGGG + Intergenic
1054399886 9:64706640-64706662 GTGGAAGAGAAGATCGAAGAGGG + Intergenic
1054433474 9:65190901-65190923 GTGGAAGAGAAGATCGAAGAGGG + Intergenic
1054496911 9:65830768-65830790 GTGGAAGAGAAGATCGAAGAGGG - Intergenic
1054588488 9:66988973-66988995 CTGGGAAAGAAGATTGAAGATGG + Intergenic
1054627094 9:67409234-67409256 CTGGAGAATAAGTTGGAAGAAGG - Intergenic
1054936952 9:70698250-70698272 ATGGAGAATCGGCTTGAAGAAGG - Intronic
1055342938 9:75304590-75304612 ATGGAGAGGAAGAATCAATATGG - Intergenic
1055433559 9:76269487-76269509 AAGGAGAAGAAGCTTAAAAAGGG + Intronic
1055654108 9:78436560-78436582 GTGGGGAGGAAGATTGAGGAAGG + Intergenic
1055986517 9:82060142-82060164 CTGGGAAAGAGGATTGAAGATGG + Intergenic
1056108871 9:83374805-83374827 ATGGAGAAGAAGAATAAAAGAGG + Intronic
1056497102 9:87168424-87168446 ATTGAGCAGAAGATTTGAGAGGG - Intergenic
1056584827 9:87920990-87921012 CTGGGAAAGAGGATTGAAGATGG - Intergenic
1056612054 9:88131950-88131972 CTGGGAAAGAGGATTGAAGATGG + Intergenic
1057160648 9:92886043-92886065 CTGGGAAAGAGGATTGAAGATGG - Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057763065 9:97891827-97891849 ATGGGGGAGAGGATTGAAGGTGG - Intergenic
1057861646 9:98645416-98645438 ATGGGAAAGAAGCTAGAAGAAGG + Intronic
1057901796 9:98954917-98954939 ATGAAGGAGAAGAGTGGAGAGGG - Intronic
1057931361 9:99196291-99196313 GTGGAGAAGAAGAGAGCAGAAGG - Intergenic
1057961552 9:99462272-99462294 ACAGAGAAGCAGATAGAAGAGGG - Intergenic
1058561501 9:106233460-106233482 AGAAAGAAGAAGATGGAAGAAGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1059550668 9:115225706-115225728 AGGGAGGAGAAGAGTGAAAATGG + Intronic
1059612039 9:115908895-115908917 ATGGAGAGGCAGATTGGAGAGGG + Intergenic
1059636077 9:116171883-116171905 AAGCAGAAGCTGATTGAAGAAGG + Intronic
1059771395 9:117429798-117429820 ATGGAGCAGAAAGTTGAGGAAGG + Intergenic
1060268021 9:122123425-122123447 ACGGAGATGAGGACTGAAGAGGG - Intergenic
1060373506 9:123097802-123097824 ATGCAGAAGAAGAGAAAAGACGG + Exonic
1060695943 9:125708955-125708977 ATGGAGAGTAAGATTTAGGAAGG - Intergenic
1060747517 9:126147287-126147309 AAGGAGAAGAAAATGGGAGAGGG + Intergenic
1062638472 9:137504051-137504073 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1185942695 X:4339133-4339155 TTGGAGAGGCAGATTGAATATGG + Intergenic
1186506693 X:10099269-10099291 GAGGAGAAGAATATTGAAAACGG - Intronic
1186978154 X:14930482-14930504 ATGGAAAAGAAGACTCAAAAAGG - Intergenic
1187025802 X:15434217-15434239 AAGAAGAAGGAGATAGAAGAAGG + Intronic
1187196230 X:17087447-17087469 GTGGAGAAGGAGTTTGTAGACGG + Intronic
1187268477 X:17759069-17759091 ATGGGGAAAAAGAATGAAAAAGG - Intergenic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1188392156 X:29634046-29634068 ACAGACAAGAAGATTTAAGAAGG + Intronic
1188448156 X:30279051-30279073 AAGGAGAAAAAAATGGAAGATGG + Intergenic
1188531286 X:31144241-31144263 ATGTTGAAGAAGATGGACGAGGG - Intronic
1188648657 X:32601804-32601826 GTGGTTAAGAAGATTGAATAAGG + Intronic
1189178736 X:38983117-38983139 AAGGAGGAGGAGAGTGAAGAGGG + Intergenic
1189214042 X:39308187-39308209 ATGGAAAAGAAGATTTAAAAAGG + Intergenic
1190428883 X:50359145-50359167 ATAGAGAGCAAGATTTAAGATGG - Intergenic
1191811913 X:65197944-65197966 TTGGAGAAAAAGAGTGAACAGGG - Intergenic
1191885600 X:65884748-65884770 GTGAAGAAGAAGATCAAAGAAGG + Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193247757 X:79249510-79249532 ATGGAGCAGAAGACTTAAGGAGG + Intergenic
1193688398 X:84607758-84607780 ATGGATAAGAAGAATCAATATGG - Intergenic
1193764242 X:85506773-85506795 ACGAACAAGAAGTTTGAAGAAGG + Intergenic
1193947906 X:87762036-87762058 ATGAAGAAAAAGATTTAAAAAGG - Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1194852971 X:98891762-98891784 ATGGATGGGAAGATGGAAGAAGG - Intergenic
1194919156 X:99743295-99743317 CTGGAGAAGAAGATTATAGGAGG + Intergenic
1195112569 X:101662057-101662079 ATGCAGAAGAAGAAAGAAAAGGG - Intergenic
1195290569 X:103428865-103428887 ATCAAGAAGATGATTAAAGAAGG - Intergenic
1196205205 X:112931519-112931541 ATGGTGAACAAGAAAGAAGATGG - Intergenic
1196338045 X:114562174-114562196 ATGGAGATGAATATTGGGGATGG + Intergenic
1196558386 X:117118772-117118794 ATGGAGGAGATGAGTGAAAACGG - Intergenic
1196690166 X:118550560-118550582 ATGGGGCAGAGGATTGAAAAGGG + Intronic
1197711547 X:129674690-129674712 ATGGAGAAAAAGAAAGAAAAGGG - Intergenic
1198013557 X:132585222-132585244 ATGGAGGAGAAGATTAAAGAGGG - Intergenic
1198520801 X:137450453-137450475 ATGGAGAAAAAAAGAGAAGAGGG - Intergenic
1198652378 X:138876802-138876824 ATGGACCAGAATATTTAAGATGG + Intronic
1199101082 X:143801317-143801339 ATGCAGAAGAAAAGAGAAGAAGG + Intergenic
1199751538 X:150824078-150824100 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751568 X:150824223-150824245 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199854739 X:151751209-151751231 ATGAACAAGAAGATTGTGGAGGG - Intergenic
1200314365 X:155116196-155116218 GTAGAGAAGAGGAGTGAAGAGGG - Intronic
1201146283 Y:11067085-11067107 AGGGAGAAGAAGGGAGAAGAAGG + Intergenic
1201146385 Y:11067399-11067421 AGGGAGAAGAAGGGAGAAGAAGG + Intergenic
1201266117 Y:12208385-12208407 TTGGAGAAGACAGTTGAAGAGGG - Intergenic
1201685997 Y:16703050-16703072 AGGCAGAAGAAGGTGGAAGAAGG - Intergenic