ID: 911526167

View in Genome Browser
Species Human (GRCh38)
Location 1:98989169-98989191
Sequence ACAGCCTATTTGGTTAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 1, 2: 4, 3: 13, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911526167 Original CRISPR ACAGCCTATTTGGTTAAAAT GGG Intronic
903288215 1:22290279-22290301 AAAGCCACTCTGGTTAAAATAGG - Intergenic
903818636 1:26083685-26083707 ACAGCCTATCTGGCCAAAGTAGG - Intergenic
904734825 1:32623631-32623653 ACAGCCTCTTTGGTAAAATTTGG - Intronic
905719860 1:40188427-40188449 CCAGTTTATTTGGTTACAATGGG - Intronic
908792777 1:67799251-67799273 TCAGACTATTTGGTAAAAATGGG - Intronic
911526167 1:98989169-98989191 ACAGCCTATTTGGTTAAAATGGG + Intronic
912248134 1:107982604-107982626 ACCAGCTATTTGGCTAAAATGGG - Intergenic
912712610 1:111960645-111960667 TCAGCCTGTATGGTTAACATGGG - Intronic
915167266 1:153955083-153955105 AGAGCCAATCTGGTTAACATTGG + Exonic
921227856 1:213038113-213038135 AAAACCTAATTGGTTAACATTGG + Intergenic
921771459 1:219045561-219045583 ACAGGCTGCTTGGCTAAAATGGG + Intergenic
922045531 1:221941716-221941738 ACAGGTTATTTGGTTAAAATGGG - Intergenic
922761761 1:228137239-228137261 ACAGGCTACTTGGTTAAAATGGG + Intergenic
923952944 1:238980585-238980607 AAAACTTATTTGGTCAAAATTGG + Intergenic
924149999 1:241120205-241120227 CCTGCCTACCTGGTTAAAATGGG + Intronic
924395698 1:243618086-243618108 ACATTCTATTTTGTTAAAACAGG + Intronic
1063744080 10:8859583-8859605 AATGCCTTTTTGGTAAAAATGGG + Intergenic
1064101446 10:12468035-12468057 AAAGCGTATTTGCATAAAATCGG - Intronic
1064376338 10:14799913-14799935 ACAGCATATTTGGTGTTAATGGG + Intergenic
1066531517 10:36345459-36345481 ACAGCACATTTGCATAAAATTGG + Intergenic
1068623839 10:59217347-59217369 AAAGCATATTTGATAAAAATGGG + Intronic
1070405994 10:76095811-76095833 ACATCATCTTTGGTTAAAGTCGG + Intronic
1071941353 10:90594947-90594969 GCAGCCTAATGGGATAAAATGGG + Intergenic
1072351175 10:94558953-94558975 TCAGCCTATTTATGTAAAATGGG - Intronic
1072513889 10:96157681-96157703 ACAGCATATTGTATTAAAATTGG + Exonic
1073662984 10:105498065-105498087 ACAGTGTATTTGATTTAAATGGG - Intergenic
1074838751 10:117326888-117326910 AAAGGCGACTTGGTTAAAATGGG + Intronic
1079418889 11:20267559-20267581 ACAGCTTAATTGGTTAAAGCTGG + Intergenic
1079519266 11:21306005-21306027 TATGCCAATTTGGTTAAAATTGG + Intronic
1081148140 11:39590007-39590029 ACACACTTTTTGGTTAAATTTGG + Intergenic
1083252914 11:61479892-61479914 ACAGCCTTTTTGCCTCAAATTGG - Intronic
1084608270 11:70185171-70185193 AGAGCCTACTTGGTTGAAGTCGG - Intronic
1086083730 11:82933429-82933451 ACAGGATATTTTGTTAAAATGGG + Exonic
1087581744 11:100064165-100064187 ACTGACTGTTTGGATAAAATGGG - Intronic
1087636301 11:100705156-100705178 TCAGATTATTTGGTTAAATTGGG - Intronic
1087885790 11:103481014-103481036 CCAGCTTTTTTGGTTAAATTTGG + Intergenic
1090790371 11:130088170-130088192 TCAGCATAATTGGTTAAACTTGG + Intronic
1092556318 12:9566044-9566066 ATAGCCTCCTTGGTTAAAAATGG - Intergenic
1093147149 12:15580537-15580559 ATAGCCTCTTTGATTAAAACAGG + Intronic
1093871521 12:24297882-24297904 ACTCCCTATTTCCTTAAAATTGG + Intergenic
1094515776 12:31124608-31124630 ATAGCCTACTTGGTTAAAAATGG + Intergenic
1095349648 12:41193428-41193450 ATAGCCAATATGGTAAAAATAGG - Intronic
1095413671 12:41951845-41951867 ACAGTCTTTTTAGTTATAATTGG + Intergenic
1095919820 12:47517867-47517889 GCAGCCTACTGGGTTTAAATAGG - Intergenic
1097328378 12:58305229-58305251 ATAGCCTATATGGTTGACATAGG - Intergenic
1099650994 12:85428110-85428132 ACATTCTGTTTGGTTAGAATGGG - Intergenic
1100735473 12:97524761-97524783 ACAGACTATTTGTTTCAAATAGG + Intergenic
1100898320 12:99210696-99210718 ATTGGCTACTTGGTTAAAATGGG + Intronic
1104043851 12:125147696-125147718 AAAGCCTATTTGGAGAATATGGG + Intergenic
1104659220 12:130597548-130597570 AAACTCTATTTGGTTAAGATGGG - Intronic
1105043525 12:132982163-132982185 CCAGACTTTTTGGTAAAAATTGG - Intergenic
1105606074 13:21927483-21927505 AGAGGCAATTAGGTTAAAATTGG + Intergenic
1106472397 13:30068798-30068820 ACAGGCGACTTGGTTAAAATGGG + Intergenic
1108450611 13:50559022-50559044 AAAGCCTCTTTTGTGAAAATAGG + Intronic
1110120230 13:71870464-71870486 GCATCCTATTTGGTTAAAAGGGG + Intergenic
1110373668 13:74767373-74767395 ACATCCCATTTAGTTGAAATGGG - Intergenic
1111650629 13:91086811-91086833 ACAGCCTTTCTTGTAAAAATGGG - Intergenic
1115793396 14:36905249-36905271 ACAGCCTATTCTGCTGAAATGGG - Intronic
1115793803 14:36909691-36909713 AAAGCATATTTAGTTAATATAGG - Intronic
1118998533 14:70859831-70859853 ACAGGCCGCTTGGTTAAAATAGG - Intergenic
1119571227 14:75675078-75675100 ACAGGCAAATTGTTTAAAATAGG + Intronic
1120351558 14:83366913-83366935 ACAGCATGTTTGGGTAAACTTGG + Intergenic
1120638677 14:86983193-86983215 ACCCCCTAAATGGTTAAAATAGG + Intergenic
1120719504 14:87875441-87875463 ACAGCCTATTGAATTTAAATAGG - Intronic
1202847935 14_GL000009v2_random:199221-199243 ACTGCCTAGTTGTTTAAAGTAGG - Intergenic
1202917411 14_GL000194v1_random:189761-189783 ACTGCCTAGTTGTTTAAAGTAGG - Intergenic
1126264373 15:46735318-46735340 ACAGCCAATGTGGTAAAACTAGG - Intergenic
1126491838 15:49245724-49245746 AGGGCCTATTTTTTTAAAATAGG + Intronic
1129569351 15:76663109-76663131 ACAGCCCATTTTTTTAAATTGGG + Intronic
1131345042 15:91638580-91638602 ACATCCTCTTTGGTGAAACTAGG + Intergenic
1135379851 16:21986735-21986757 ACAGATTATTTCATTAAAATTGG + Intronic
1138022640 16:53498357-53498379 ACAAACTATTTGGTTAAATTAGG - Intronic
1139422396 16:66856746-66856768 ACATCCCATTTGGATATAATAGG - Intronic
1140907202 16:79418953-79418975 ACAATTTATTTGATTAAAATGGG + Intergenic
1146553423 17:33801984-33802006 TCAGGCTAATTGGTAAAAATTGG + Intronic
1149272682 17:54998291-54998313 AAAGCTTATATGGTTAAAAAGGG - Intronic
1149928880 17:60729430-60729452 ACAGCCTATTTGGAAAACCTTGG - Intronic
1150877847 17:68989443-68989465 ACAGCCCATTTCGTGAAAGTGGG - Intronic
1153431085 18:5018134-5018156 AATTTCTATTTGGTTAAAATGGG - Intergenic
1155545334 18:26908633-26908655 AGAGCCAATGTGGTTAGAATTGG + Exonic
1155644306 18:28058943-28058965 ACAGGCTATTTGGTTAAAACAGG + Intronic
1159738316 18:72132445-72132467 ACAGTCGATTTAGTTAAATTGGG + Intergenic
1159806521 18:72963986-72964008 AAAGCCTATTTGGGTAATTTGGG + Intergenic
1161830744 19:6602446-6602468 AAAGCCTATTTGCTTAAGAAGGG + Intronic
1166273196 19:41731365-41731387 ACATGCTGCTTGGTTAAAATGGG + Intronic
1166323720 19:42036356-42036378 CCAGCCTATTTTTTTAAAACAGG + Intronic
1166457918 19:42959477-42959499 TCTGCCTATTTTGTTAAATTGGG + Intronic
1166625842 19:44355222-44355244 GAAGCCTATTTGGTTAAACATGG + Intronic
1167817547 19:51897048-51897070 GCAGCTTATGTGGTGAAAATGGG - Intronic
1202675281 1_KI270710v1_random:39366-39388 ACTGCCTAGTTGTTTAAAGTAGG - Intergenic
925841718 2:7998207-7998229 ACATCGTCTGTGGTTAAAATGGG - Intergenic
926935382 2:18082579-18082601 CCTGCCTCTTTGGTTCAAATGGG - Intronic
931060317 2:58521619-58521641 ACAGCCTATTTGATGCCAATTGG + Intergenic
933815779 2:86067718-86067740 AGAGCTGATTTGGTTAAACTAGG - Intronic
935840398 2:107102972-107102994 ACAGCCTCTTAGCTCAAAATTGG + Intergenic
938547604 2:132348921-132348943 GAAGCCTATTTGGTTAAACATGG - Intergenic
938601408 2:132845003-132845025 CCAGTCTATTTGGTGAAAAAAGG + Intronic
939228035 2:139388378-139388400 AGAGCCTATTTTTGTAAAATTGG + Intergenic
939452869 2:142396687-142396709 ACAGAGAATTTGGTTAAAAAAGG - Intergenic
939665623 2:144947540-144947562 TCAGCCTAATTGGTATAAATCGG + Intergenic
940235409 2:151506048-151506070 ACAGCTTATATTGCTAAAATAGG - Intronic
941406274 2:165092714-165092736 AAAGCATATTTGGTTTATATAGG + Intronic
942034639 2:171999185-171999207 ACAGTGAATTTGGTAAAAATGGG + Intronic
945255091 2:207796761-207796783 ACAGGCTATTTGGGGAAGATGGG + Intergenic
945319204 2:208402095-208402117 ACTGCCTTGTTGGTAAAAATAGG - Intronic
1171876471 20:30581681-30581703 GAAGCCTATTTGGTTAAACGTGG - Intergenic
1174324574 20:49768995-49769017 TCAGTCTATATGGTTAAAGTGGG - Intergenic
1176636663 21:9250802-9250824 ACTGCCTAGTTGTTTAAAGTAGG + Intergenic
949784649 3:7727670-7727692 GAAGCCTATGTGGTTAAATTGGG - Intronic
949846002 3:8371728-8371750 ACAACATATTTGGTTGAAGTTGG - Intergenic
951035105 3:17924225-17924247 ACAGCCTAGGAGGATAAAATGGG + Intronic
954307754 3:49739011-49739033 ACAACCCATTTGATTAAAATGGG - Intronic
955087115 3:55713644-55713666 ACATGCTTTTTGGTGAAAATAGG - Intronic
956513560 3:70021092-70021114 ACAGCCAATGTGGTGAAAAGAGG - Intergenic
957104099 3:75864462-75864484 ACTGCCTAGTTGTTTAAAGTAGG - Intergenic
958066303 3:88548353-88548375 AGTGACTATTGGGTTAAAATTGG - Intergenic
959505572 3:107152827-107152849 GGAACCTATTTGGTGAAAATAGG + Intergenic
961337331 3:126188917-126188939 ACAGGCTATTTGGTTAAAATGGG - Intronic
961849087 3:129796992-129797014 AGATCCTATTTGGTGATAATTGG - Intronic
962172152 3:133112883-133112905 ACAGGATTTATGGTTAAAATGGG + Intronic
963914488 3:150845463-150845485 ACAGGCTGCTTGGTCAAAATGGG - Intergenic
964742021 3:159976243-159976265 ATAGCCTATTTGGTTACCACTGG + Intergenic
966431661 3:179837822-179837844 ACAGGCTGCTTGGTTAAAACAGG + Intronic
1202750232 3_GL000221v1_random:154217-154239 ACTGCCTAGTTGTTTAAAGTAGG - Intergenic
970126835 4:12823248-12823270 ACAGGCTGCTTGGTTAAAACAGG + Intergenic
970980236 4:22087386-22087408 ACATCCTAGTTGATTACAATAGG - Intergenic
971852945 4:32007640-32007662 ACATGCTATATTGTTAAAATAGG + Intergenic
972434006 4:39014130-39014152 ACAGCCTCTTTTGTTTAAAATGG - Intronic
972950923 4:44321205-44321227 ATAGCTTATATAGTTAAAATAGG - Intronic
976797114 4:88946652-88946674 ACGGGCTACTTGGTTAAAACAGG + Intronic
978049291 4:104176024-104176046 ATAGCCTGTTAGGTAAAAATGGG - Intergenic
978594673 4:110364497-110364519 ACAGTCTAATAGGTTAAAAATGG + Intergenic
980399641 4:132264448-132264470 ACAAAATATTAGGTTAAAATAGG + Intergenic
980678351 4:136120795-136120817 AAAGCCTAATTGGTAATAATAGG - Intergenic
980702044 4:136443334-136443356 ACAGTCTATTAGGTTAAATTAGG - Intergenic
981410393 4:144423414-144423436 ACAGCCTACATGTTTGAAATAGG - Intergenic
983649506 4:170024630-170024652 CCAGACTATTTGGCTAAAATGGG + Intronic
984353804 4:178631857-178631879 AGAGACTATTTTGATAAAATTGG - Intergenic
1202751552 4_GL000008v2_random:9239-9261 ACTGCCTAGTTGTTTAAAGTAGG + Intergenic
986872485 5:12066177-12066199 AAAGTCTAAGTGGTTAAAATGGG - Intergenic
990145963 5:52760521-52760543 ACAGCCTGTTGGGTTACAAGGGG - Intergenic
993712236 5:91237046-91237068 TCAGCCTACTTGGTTAAAATGGG - Intergenic
996173275 5:120323093-120323115 ACTGCCTATTTGATTAATTTGGG + Intergenic
996967731 5:129324321-129324343 AGAGTGTTTTTGGTTAAAATTGG - Intergenic
997603001 5:135153199-135153221 AAAGCTGCTTTGGTTAAAATGGG + Intronic
997885219 5:137624005-137624027 ATAGCCTGTTAGGTTAAAAAAGG - Intronic
998375162 5:141685866-141685888 ACAGGCTGATTGATTAAAATAGG - Intergenic
1001780606 5:174365831-174365853 ACAGGCTATTTTTATAAAATTGG - Intergenic
1004455776 6:15790283-15790305 ACAGCCTATTAAGTTACATTTGG - Intergenic
1005442527 6:25885744-25885766 GCAGCTTATTTGGATAGAATTGG - Intergenic
1005726901 6:28658164-28658186 ACAGCCTATTTCTGTAGAATCGG - Intergenic
1010898443 6:81395269-81395291 AGTCCCTATTAGGTTAAAATGGG - Intergenic
1011288185 6:85747140-85747162 ACAGGCTACTTGCCTAAAATAGG - Intergenic
1013768401 6:113599314-113599336 ACAGCATGTTTTGTTAAGATTGG - Intergenic
1013953434 6:115812698-115812720 CCATCCTATTTGCTTTAAATAGG + Intergenic
1014491695 6:122070651-122070673 ACAGCCTGGTTGCTGAAAATGGG - Intergenic
1016416845 6:143842704-143842726 ATAGCCTATTTGTTTAAACAGGG + Intronic
1020880844 7:13761714-13761736 ACAGGCTGCTTGGTTAAAATGGG - Intergenic
1021379166 7:19946127-19946149 AGAGTCTACTTGGTAAAAATGGG - Intergenic
1022631614 7:32090729-32090751 ATAACCTATTTTGTTCAAATAGG - Intronic
1022862166 7:34378647-34378669 ATAGGCTGCTTGGTTAAAATGGG - Intergenic
1027374287 7:77535743-77535765 TCAGCGAATTTGGTTATAATAGG - Intergenic
1030415075 7:109232820-109232842 AATGGCTAATTGGTTAAAATGGG - Intergenic
1030420015 7:109297500-109297522 ACATCCTATTTAGATAGAATAGG - Intergenic
1031510738 7:122646374-122646396 ACAGGCTTTTGGGTTATAATGGG + Intronic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1034554839 7:151843801-151843823 ACACTCTGTTTGGTTAAGATCGG + Intronic
1036079525 8:5540025-5540047 ACAGACTATTGGCTTAGAATGGG - Intergenic
1041099063 8:54378537-54378559 AATGCCTATTTGAATAAAATTGG - Intergenic
1041415630 8:57605127-57605149 ATAGCTTATTGGATTAAAATAGG + Intergenic
1041793363 8:61721013-61721035 GCAGCCTATCTGTTTAACATTGG - Intergenic
1044330333 8:90912436-90912458 ACAGAATATCTGGTTAAGATAGG + Intronic
1046033479 8:108811953-108811975 GCAGGCTACTTGGTTAAAATGGG + Intergenic
1046339547 8:112835220-112835242 ACAGGATATTTTGTTAAAAGTGG + Intronic
1050263600 9:3866922-3866944 AGAGGCTATTTGCTTAAGATGGG + Intronic
1052505838 9:29352918-29352940 ACAGAATATTTGGTCAAATTGGG - Intergenic
1055680824 9:78713234-78713256 ACAGCATATTTGCCTACAATAGG + Intergenic
1055926743 9:81518275-81518297 ACAACCCATTTGGTAAAAACAGG - Intergenic
1058922893 9:109634461-109634483 ACAGCCTGTTTAGTTAAACACGG + Intergenic
1059736692 9:117107414-117107436 ACAGCTGATTGGGATAAAATTGG - Intronic
1203718872 Un_KI270742v1:184311-184333 ACTGCCTAGTTGTTTAAAGTAGG - Intergenic
1203653103 Un_KI270751v1:147990-148012 ACTGCCTAATTGTTTAAAGTAGG - Intergenic
1187146789 X:16644487-16644509 AGAGCCTTTGTGGTTACAATGGG - Intronic
1188920834 X:35974660-35974682 ACAGCTTAATTAGTTAAAACTGG - Intronic
1190819006 X:53955869-53955891 TCATCCTATTGGGTTAAACTTGG + Intronic
1192487934 X:71546897-71546919 GTAGCCTTTTTGGATAAAATTGG + Intronic
1197037364 X:121890434-121890456 ACAGGAATTTTGGTTAAAATTGG + Intergenic
1198401636 X:136274227-136274249 CCTGCCAATTTGGTTAATATAGG + Intergenic
1198833923 X:140781389-140781411 CCAGCCTATTTAATTAAATTAGG + Intergenic
1199604964 X:149569941-149569963 ACAGGCTGGTTGGTTAGAATGGG - Intergenic
1201173028 Y:11289148-11289170 ACTGCCTAGTTGTTTAAAGTAGG - Intergenic