ID: 911530626

View in Genome Browser
Species Human (GRCh38)
Location 1:99039398-99039420
Sequence GAGGGTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911530616_911530626 24 Left 911530616 1:99039351-99039373 CCATATTCATCTCACTGGGACTG No data
Right 911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911530626 Original CRISPR GAGGGTGAGCAGAAGCAGGA TGG Intergenic
No off target data available for this crispr