ID: 911530682

View in Genome Browser
Species Human (GRCh38)
Location 1:99039703-99039725
Sequence CTGGCTTCTGCCCGCTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911530682_911530684 3 Left 911530682 1:99039703-99039725 CCTGGAAAGCGGGCAGAAGCCAG No data
Right 911530684 1:99039729-99039751 ACCAAGTTGTCTTGCTCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911530682 Original CRISPR CTGGCTTCTGCCCGCTTTCC AGG (reversed) Intergenic
No off target data available for this crispr