ID: 911534388

View in Genome Browser
Species Human (GRCh38)
Location 1:99082668-99082690
Sequence CTATCTATACTTAAAGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911534384_911534388 23 Left 911534384 1:99082622-99082644 CCAGAGCAAAGAATTGTCTTGTA No data
Right 911534388 1:99082668-99082690 CTATCTATACTTAAAGTGGTAGG No data
911534383_911534388 24 Left 911534383 1:99082621-99082643 CCCAGAGCAAAGAATTGTCTTGT No data
Right 911534388 1:99082668-99082690 CTATCTATACTTAAAGTGGTAGG No data
911534386_911534388 -2 Left 911534386 1:99082647-99082669 CCATGCTAAATAGTTGGAAGTCT No data
Right 911534388 1:99082668-99082690 CTATCTATACTTAAAGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911534388 Original CRISPR CTATCTATACTTAAAGTGGT AGG Intergenic
No off target data available for this crispr