ID: 911536419

View in Genome Browser
Species Human (GRCh38)
Location 1:99105963-99105985
Sequence AGTGCGGGTAGAGCACCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911536414_911536419 -1 Left 911536414 1:99105941-99105963 CCTTAGGAACCAGCTTGGCCACA No data
Right 911536419 1:99105963-99105985 AGTGCGGGTAGAGCACCAACTGG No data
911536417_911536419 -10 Left 911536417 1:99105950-99105972 CCAGCTTGGCCACAGTGCGGGTA No data
Right 911536419 1:99105963-99105985 AGTGCGGGTAGAGCACCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911536419 Original CRISPR AGTGCGGGTAGAGCACCAAC TGG Intergenic
No off target data available for this crispr