ID: 911539969

View in Genome Browser
Species Human (GRCh38)
Location 1:99146468-99146490
Sequence CTGGATCCACAACTGCAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911539969_911539979 5 Left 911539969 1:99146468-99146490 CCAAATTGCAGTTGTGGATCCAG No data
Right 911539979 1:99146496-99146518 CTGTGCTCTTGGGGGCCTGGGGG No data
911539969_911539978 4 Left 911539969 1:99146468-99146490 CCAAATTGCAGTTGTGGATCCAG No data
Right 911539978 1:99146495-99146517 TCTGTGCTCTTGGGGGCCTGGGG No data
911539969_911539977 3 Left 911539969 1:99146468-99146490 CCAAATTGCAGTTGTGGATCCAG No data
Right 911539977 1:99146494-99146516 CTCTGTGCTCTTGGGGGCCTGGG No data
911539969_911539970 -6 Left 911539969 1:99146468-99146490 CCAAATTGCAGTTGTGGATCCAG No data
Right 911539970 1:99146485-99146507 ATCCAGCCTCTCTGTGCTCTTGG No data
911539969_911539971 -5 Left 911539969 1:99146468-99146490 CCAAATTGCAGTTGTGGATCCAG No data
Right 911539971 1:99146486-99146508 TCCAGCCTCTCTGTGCTCTTGGG No data
911539969_911539974 -3 Left 911539969 1:99146468-99146490 CCAAATTGCAGTTGTGGATCCAG No data
Right 911539974 1:99146488-99146510 CAGCCTCTCTGTGCTCTTGGGGG No data
911539969_911539973 -4 Left 911539969 1:99146468-99146490 CCAAATTGCAGTTGTGGATCCAG No data
Right 911539973 1:99146487-99146509 CCAGCCTCTCTGTGCTCTTGGGG No data
911539969_911539976 2 Left 911539969 1:99146468-99146490 CCAAATTGCAGTTGTGGATCCAG No data
Right 911539976 1:99146493-99146515 TCTCTGTGCTCTTGGGGGCCTGG No data
911539969_911539981 23 Left 911539969 1:99146468-99146490 CCAAATTGCAGTTGTGGATCCAG No data
Right 911539981 1:99146514-99146536 GGGGGAACCTGTGCTCTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911539969 Original CRISPR CTGGATCCACAACTGCAATT TGG (reversed) Intergenic
No off target data available for this crispr