ID: 911542534

View in Genome Browser
Species Human (GRCh38)
Location 1:99175399-99175421
Sequence ATGATACTTGAGAGATGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911542531_911542534 14 Left 911542531 1:99175362-99175384 CCATCAGAACTAAATCAAGATGA No data
Right 911542534 1:99175399-99175421 ATGATACTTGAGAGATGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911542534 Original CRISPR ATGATACTTGAGAGATGTTT AGG Intergenic