ID: 911545015

View in Genome Browser
Species Human (GRCh38)
Location 1:99206135-99206157
Sequence CTGCATCCACATATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911545009_911545015 3 Left 911545009 1:99206109-99206131 CCAGGACCAAGGTTCCAGCTGTC No data
Right 911545015 1:99206135-99206157 CTGCATCCACATATGGAGGAAGG No data
911545011_911545015 -3 Left 911545011 1:99206115-99206137 CCAAGGTTCCAGCTGTCTGGCTG No data
Right 911545015 1:99206135-99206157 CTGCATCCACATATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911545015 Original CRISPR CTGCATCCACATATGGAGGA AGG Intergenic
No off target data available for this crispr