ID: 911547301

View in Genome Browser
Species Human (GRCh38)
Location 1:99233777-99233799
Sequence TAAGCTACTGACATTGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911547300_911547301 19 Left 911547300 1:99233735-99233757 CCAGCAAATACAATGGCTGGTAA No data
Right 911547301 1:99233777-99233799 TAAGCTACTGACATTGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911547301 Original CRISPR TAAGCTACTGACATTGAATC AGG Intergenic
No off target data available for this crispr