ID: 911550484

View in Genome Browser
Species Human (GRCh38)
Location 1:99273269-99273291
Sequence GGTTTCTGCCTGTGTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 759
Summary {0: 1, 1: 1, 2: 8, 3: 92, 4: 657}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911550484 Original CRISPR GGTTTCTGCCTGTGTAAAAC TGG Intronic
901447134 1:9315465-9315487 GGTTTCCTCATCTGTAAAACGGG - Intronic
901757241 1:11448852-11448874 CGTTTCTTCCTCTGTAAAAGGGG + Intergenic
901921609 1:12541153-12541175 AGTTTCTCCATGTGTAAAAAGGG - Intergenic
902240779 1:15087925-15087947 GGTTTTCCCCTCTGTAAAACGGG - Intronic
902334849 1:15748929-15748951 AGTTTCTGACTCTGTAAAAAGGG - Intergenic
902514989 1:16985288-16985310 GGTTTCTTCATCTGTAAAATGGG + Intergenic
902605868 1:17569115-17569137 AGTTTCCTCCTCTGTAAAACAGG + Intronic
902629213 1:17694920-17694942 AGTTTCCGCCTGTGTAAAGTGGG - Intronic
902780644 1:18702654-18702676 GGTTTCTTCATCTGTAAAATGGG + Intronic
902821959 1:18948941-18948963 AGTTTCTTCATCTGTAAAACAGG - Intronic
903367423 1:22813713-22813735 GGTTTCTTCCTCTGCAAAATGGG + Intronic
903503650 1:23816997-23817019 TGTTTCTGCATATGTAAAGCTGG - Intronic
903563986 1:24250620-24250642 AGTTTCTGCATCTGCAAAACAGG - Intergenic
903825412 1:26141342-26141364 TGTTTCTTCATCTGTAAAACAGG + Intergenic
903968676 1:27105183-27105205 AGTTTCTGCATCTGTAAAATGGG - Intronic
904277998 1:29396598-29396620 AGTTTCTGCCTCTGTAAAATGGG + Intergenic
904375709 1:30081007-30081029 TGTTTCTTCATCTGTAAAACAGG - Intergenic
904380246 1:30105826-30105848 AGTTTCTTCATCTGTAAAACTGG - Intergenic
904380283 1:30106149-30106171 AGTTTCCTCCTCTGTAAAACGGG - Intergenic
904481321 1:30795562-30795584 GGTTTCTTTCTCTGTAAAATGGG - Intergenic
904541209 1:31234589-31234611 AGTTTCTTCCTTTGTAAAAGAGG - Intronic
904593267 1:31627077-31627099 GGTTTCTGCCTGTGTGACTCTGG + Exonic
904666646 1:32127147-32127169 TGCTTCTGCCTCTCTAAAACAGG - Intronic
904767916 1:32864522-32864544 GGCTGCTGCCTGTGTGACACAGG - Intronic
904805416 1:33128003-33128025 AGTTTCTGACTCTGTAAAATAGG + Intergenic
904814412 1:33184293-33184315 GGTATCTTCCTCTATAAAACGGG - Intergenic
904825917 1:33273606-33273628 GGTTTCCTCCTCTGTAAAATGGG - Intronic
905102357 1:35535528-35535550 AGTTTTTTCATGTGTAAAACAGG + Intronic
905130346 1:35750734-35750756 GTTTTCTGCCTAGGGAAAACAGG - Intronic
905481752 1:38266528-38266550 GGTTTCTTCATCTGTAAAAGTGG + Intergenic
905627285 1:39497640-39497662 GCTTTCTGCCTGTGTGACCCAGG + Intronic
905631085 1:39518917-39518939 AGTTTCTGCTTCTGTAAAATGGG + Intronic
905666676 1:39767259-39767281 AGTTTCTGCTTCTGTAAAATGGG - Intronic
905827731 1:41038926-41038948 AGTTTCTTCATGTGTAAAATGGG + Intronic
906290442 1:44616451-44616473 AGTTTCTTCCTCTGTAAAATGGG - Intronic
907331461 1:53674485-53674507 GGTTTCCACATGTGTAAAATGGG + Intronic
907654479 1:56328305-56328327 TGTTTCTTCATTTGTAAAACAGG + Intergenic
907656356 1:56346024-56346046 TGTTTCTTCCTGTTTTAAACTGG - Intergenic
907960924 1:59280274-59280296 GGTTTCTTCCTCTGAAAAATGGG - Intergenic
908113434 1:60919045-60919067 AGTTTCTGCATATGTAAAATGGG - Intronic
908225868 1:62055506-62055528 AGTTTATGCCTCTGTAAAATGGG + Intronic
908246179 1:62229170-62229192 AGTTTCTGCATATGTAAAACAGG + Intergenic
908312478 1:62899007-62899029 AGTTTCTTCCTCTGTAAAATGGG + Intergenic
909798376 1:79773410-79773432 GGTTTCTTCATCTGTAAAACAGG - Intergenic
910412105 1:86957300-86957322 TGTTTCTTCCTCTGTAAAATGGG - Intronic
910442247 1:87264983-87265005 AGTTTCTTCATCTGTAAAACAGG - Intergenic
911213499 1:95167165-95167187 GGTTTCTCCTTTTGTAAAATGGG - Intronic
911272066 1:95814368-95814390 AGTTTCTGTGTCTGTAAAACGGG + Intergenic
911550484 1:99273269-99273291 GGTTTCTGCCTGTGTAAAACTGG + Intronic
912201477 1:107462856-107462878 GGCTTCTGCATCTATAAAACAGG - Intronic
912597069 1:110889700-110889722 AATTTCTTCCTATGTAAAACGGG - Intronic
912710075 1:111943805-111943827 AGTTTCTTCCTCTGTAAAATGGG - Intronic
912868104 1:113277326-113277348 GGTTTCTTCCTCTGTGAAATGGG - Intergenic
913067358 1:115268789-115268811 GGTTTCTTCTTCTGTAAAATGGG + Intergenic
913119209 1:115724261-115724283 AGTTTCTGACTATGTCAAACGGG + Intronic
916426224 1:164683264-164683286 GGTTTCTTCTTCTGTAAAATGGG - Intronic
917298307 1:173545329-173545351 GATTTCTGCCTGTAGAAAACTGG - Intronic
917745076 1:177998878-177998900 GGTTTCTTCACCTGTAAAACAGG - Intergenic
917922629 1:179763737-179763759 AGTTTCTGCATCTGTAAAATGGG - Intronic
918250403 1:182698406-182698428 AGTTTCTGCATCTGTAAAACAGG + Intergenic
919631475 1:199964175-199964197 AGTTTCTTCCTCTGTAAAATGGG + Intergenic
919800162 1:201349088-201349110 AGTTTCTTCATCTGTAAAACAGG - Intergenic
919802021 1:201359827-201359849 GGCTTCTGCCTGTGGTACACGGG - Intronic
920432577 1:205928225-205928247 AGTTTCCTCCTTTGTAAAACAGG - Intronic
920438550 1:205963602-205963624 GGATTCTCCCTCTGTAAAATGGG + Intergenic
920705877 1:208250180-208250202 GGTTTCAGCATCTGTAAAATGGG - Intergenic
921059113 1:211567630-211567652 GGTTTCTGGCTTTATAAAAGAGG - Intergenic
921290199 1:213650006-213650028 AGTTTCCTCATGTGTAAAACAGG - Intergenic
921544351 1:216456319-216456341 TGTTTCTTCATGTATAAAACTGG + Intergenic
922034245 1:221832981-221833003 GTTTTCTGTCTGTGTAATGCAGG + Intergenic
922195178 1:223353484-223353506 GGTTTCTTCATCTGTAAATCAGG - Intronic
923305379 1:232683344-232683366 GCTTTCTCACTGTGTGAAACAGG - Intergenic
923418481 1:233789133-233789155 AGTTTCTTCATTTGTAAAACTGG + Intergenic
1062997596 10:1881631-1881653 GCTTCCTGCCTGTGGAAAACCGG - Intergenic
1064012249 10:11743787-11743809 AGTTTCTGCTTCTGTAAATCTGG + Intronic
1064373612 10:14775903-14775925 GGTTTCTGCCTCTGTAAAACGGG - Intergenic
1065179612 10:23111550-23111572 GGTTTCTGCATCTGAAAAAGGGG + Intronic
1065447415 10:25817512-25817534 GGTTTCTCTCTATGTAAAAGGGG + Intergenic
1065668164 10:28085275-28085297 AGTTTCTTCATCTGTAAAACAGG + Intronic
1067172721 10:43921502-43921524 GGTTTCTGTATCTGTAAAATGGG + Intergenic
1067543996 10:47178733-47178755 AGTTTCTTCCTCTGTAAAATGGG + Intergenic
1068720121 10:60235937-60235959 TGTTTCTGCATGTGTAAAATGGG - Intronic
1069530657 10:69216762-69216784 GGTTTCTCCATCTGTAAAATAGG + Intergenic
1069539654 10:69284266-69284288 AGTTTCCTCATGTGTAAAACTGG + Intronic
1069560949 10:69428959-69428981 GGTTTCTTCCTTTGTAAAATGGG - Intergenic
1069609278 10:69761763-69761785 GGTTTGAGCATCTGTAAAACGGG + Intergenic
1069723803 10:70565147-70565169 AGTCTCTGCCTCTGTAAAATGGG - Intronic
1069896281 10:71682193-71682215 GGTTTCTTCATCTGTAAAAGTGG + Intronic
1070548958 10:77475550-77475572 GGTTTCTTCATCTGTAAAATGGG - Intronic
1070718499 10:78739958-78739980 AGTTTCCGCCTCTGTAAAATAGG + Intergenic
1071787841 10:88922376-88922398 GGTTTCTGCTTGTAAAAAAAAGG + Exonic
1071816665 10:89239362-89239384 GGTTTCCTCATCTGTAAAACAGG + Intronic
1072038720 10:91587949-91587971 TGTTTTTTCCTTTGTAAAACAGG + Intergenic
1072441912 10:95464407-95464429 GGTGTCTTCATCTGTAAAACAGG + Intronic
1072681336 10:97509323-97509345 AGTTTCTGCATCTGTAAAATGGG + Intronic
1072736699 10:97883947-97883969 GTTTTCTTCCTCTGTAAAATGGG + Intronic
1073102264 10:101012570-101012592 TGTTTCCGCATCTGTAAAACGGG - Intronic
1073177206 10:101563914-101563936 AGTTTATACATGTGTAAAACAGG + Intergenic
1073199055 10:101719928-101719950 GGTTTCTTCATTTGTAAAATAGG + Intergenic
1073530160 10:104223451-104223473 AGTTTCTTCCTCTGTAAAATGGG - Intronic
1074126455 10:110532307-110532329 GGTTTTTACCCCTGTAAAACAGG - Intergenic
1074357936 10:112802434-112802456 GGTTTCCTCCTCTGTAAAAATGG + Intronic
1074365463 10:112854313-112854335 TGTTTCTGCATTTGTAAAACAGG - Intergenic
1074370477 10:112896857-112896879 AGTTTCTGCATCTGTAAAATGGG - Intergenic
1074569274 10:114609889-114609911 GGTTTCCTCCTCTGCAAAACAGG - Intronic
1075056386 10:119221973-119221995 GGATTTTGCATGTGTAAATCAGG + Intronic
1075283244 10:121159606-121159628 GGTGTCTGCATCTATAAAACAGG - Intergenic
1075479292 10:122766159-122766181 GGTTTCTGCATTTGTAAAATAGG + Intergenic
1075541435 10:123317537-123317559 AGTTTCTGCATCTGTAAAATGGG - Intergenic
1076321460 10:129585181-129585203 GATATCTTCTTGTGTAAAACGGG + Intronic
1077464525 11:2727324-2727346 TGTTTCTTCATCTGTAAAACAGG + Intronic
1077602462 11:3582854-3582876 GGTCTCTTCCTCTGTAAAATGGG - Intergenic
1078430607 11:11285305-11285327 AGTTTCCTCCTCTGTAAAACTGG + Intronic
1078844887 11:15111888-15111910 AGTTTCTTCATGTGTAAAATAGG + Intergenic
1079098746 11:17527540-17527562 GGTTTCTCCATCTGTAAAATGGG - Intronic
1079123346 11:17700312-17700334 TGTTTCCTCCTCTGTAAAACTGG + Intergenic
1079158996 11:17975230-17975252 GGTTTCCTCATGTGTAAAATGGG + Intronic
1080239371 11:30108836-30108858 TGTTTCTTCATATGTAAAACAGG + Intergenic
1080349395 11:31366109-31366131 GGTTTCTTCCTCTGTAATATGGG - Intronic
1080451620 11:32382924-32382946 GGTTTCTTCATCTGTAAAATGGG + Intergenic
1080853766 11:36093891-36093913 GGTTTGTGACTGTGCAAAAAAGG + Intronic
1083172551 11:60931584-60931606 AGTTTCCTCCTGTGTAAAATGGG + Intronic
1083391461 11:62354150-62354172 TGTTTCTTCATGTGTAAAATGGG - Intronic
1083411279 11:62494503-62494525 AGTTTCTTCTTGTGTAAAACGGG - Intronic
1083478314 11:62927837-62927859 GGTTTCTTCATCTGTAAAATAGG - Intergenic
1083963376 11:66026889-66026911 AGTTTCTTCCTCTGTAAAATGGG + Intergenic
1084212235 11:67629599-67629621 GGTTTCCGCCTCCGTAAAATGGG - Intronic
1084265066 11:68000836-68000858 GGTTTCTTCATGTCTAAGACTGG + Intronic
1084471116 11:69359423-69359445 AGTTTCTCCCTCTGTAAAATGGG + Intronic
1084574868 11:69982618-69982640 GGTTTGTGCATCTGTAAAATGGG - Intergenic
1085304497 11:75477469-75477491 AGTTTCTCCCTCTGTAAAATGGG - Intronic
1085386254 11:76159985-76160007 GGTTTCTTCATTTGAAAAACGGG - Intergenic
1085642103 11:78199179-78199201 AGTTTCTTCCTCTGTAAAATGGG - Intronic
1085756781 11:79208396-79208418 GGTTTCCTCATGTGTAAAATGGG + Intronic
1085798255 11:79563616-79563638 AGTTTCTTCATGTGTAAAATAGG - Intergenic
1085918319 11:80919481-80919503 GGTTTCCACATGTGTAAAACTGG - Intergenic
1086251229 11:84816945-84816967 AGTTTCTGCATCTGTAAAATAGG + Intronic
1086421756 11:86644394-86644416 GGTTTCATCCTCTGTAAAGCAGG - Intronic
1087128304 11:94647323-94647345 AGTTTCTTCATCTGTAAAACAGG - Intergenic
1087549623 11:99632464-99632486 GATTTCTGTCTGTGTAATCCTGG - Intronic
1089012796 11:115144355-115144377 AGTTTCTGCCTTTGTAAAATGGG - Intergenic
1089062643 11:115638412-115638434 GGTTTCTTCATCTGTTAAACTGG + Intergenic
1089616471 11:119697628-119697650 AGTTTCTCCCTCTGTAAAATGGG - Intronic
1089702933 11:120256263-120256285 AGTTTCTTCCTTTATAAAACAGG + Intronic
1089876214 11:121724127-121724149 GTTTTCCTCCTTTGTAAAACAGG + Intergenic
1090259911 11:125312086-125312108 TGTTTCTTCATGTGTAAAATGGG + Intronic
1090970139 11:131634760-131634782 TGTTTCTGTCTTTGTAAAATGGG + Intronic
1091810196 12:3390572-3390594 TGTTTCTTCCTGTGCAGAACAGG - Intronic
1091914660 12:4262114-4262136 GGTTTCCTCATCTGTAAAACTGG - Intergenic
1091975821 12:4824033-4824055 GGTGTCTGCCTGTGTGACCCGGG + Intronic
1091975829 12:4824082-4824104 GGTTTTCTCCTCTGTAAAACTGG + Intronic
1092236814 12:6815585-6815607 GGTTTCAGCCTCTGTGAAATGGG + Intronic
1092295448 12:7193894-7193916 TGTCTCTGCCTCTGTGAAACAGG - Intronic
1092680406 12:10973579-10973601 GGTTTCTGCCTGTATCAGACAGG - Intronic
1092901456 12:13063287-13063309 GGTTTCTTCATATGTAAAAAAGG + Intronic
1092902160 12:13070076-13070098 AGTTTCTGCATTTATAAAACAGG + Intronic
1093506352 12:19871326-19871348 AGTTTCTTCCTCTTTAAAACTGG + Intergenic
1093686395 12:22059429-22059451 GTTTTCCTCCTCTGTAAAACTGG - Intronic
1093996843 12:25652203-25652225 GGTTTCAGTCTATGCAAAACAGG + Intergenic
1094229906 12:28091156-28091178 AGTTTCTGCATCTGTAAAATGGG + Intergenic
1095605021 12:44056859-44056881 AGTTTCTTCATCTGTAAAACTGG - Intronic
1095965031 12:47861392-47861414 GGATTGGGCCTGTGTGAAACTGG - Intronic
1096223554 12:49848566-49848588 AGTTTCTGTCTGGGAAAAACAGG + Intergenic
1096240645 12:49958253-49958275 GGTTTCTGAATCTGTAAAATGGG - Exonic
1096521014 12:52184602-52184624 AGTTTCTTCCTGTGTGAAACGGG - Intronic
1098272595 12:68783383-68783405 AGTTTCTGCATCTGTAAAATGGG - Intronic
1098391931 12:69978751-69978773 GATTTCTTCATGTGTAAAATAGG + Intergenic
1099055707 12:77837525-77837547 AGTTTCTCCATCTGTAAAACGGG - Intronic
1099193186 12:79582073-79582095 GGTTTCTCCATGTGTCAAGCTGG - Intronic
1100004937 12:89883575-89883597 AATTTCCTCCTGTGTAAAACTGG - Intergenic
1100326101 12:93541245-93541267 GGTTTTTTCATGTGTAAAATGGG + Intergenic
1100524755 12:95408861-95408883 GGTTTCTTCATCTGTAAAATGGG + Intergenic
1101007315 12:100413543-100413565 GGTTTCTGCTCCTGTAAAATGGG - Intronic
1101245445 12:102880043-102880065 AGTTTCTTCATCTGTAAAACGGG - Intronic
1101735160 12:107457962-107457984 AGTTTCTTCCTTTGTAAAATAGG + Intronic
1101894575 12:108746292-108746314 AGTTTCTTCCTCTGTAAAATGGG - Intergenic
1102028070 12:109724687-109724709 AGTTTCTTCCTCTGTAAAATGGG + Intronic
1102213911 12:111146812-111146834 GGTTTCTCCTTCTGTAAAATGGG + Intronic
1102247808 12:111366247-111366269 TGTTTCTGCATCTGTAAAATGGG + Exonic
1102283354 12:111635619-111635641 AGTTTCTTGCTGTGTAAAATGGG + Intergenic
1102514719 12:113438664-113438686 AGTTTCTGCATCTGTAAAATGGG - Intergenic
1102566834 12:113802570-113802592 AGTTTCCTCCTCTGTAAAACGGG - Intergenic
1102655093 12:114475956-114475978 GGTCTCTGCCTCTGTAAAATGGG - Intergenic
1102805179 12:115773559-115773581 GGTTTCTGCCTCTGTGAAATGGG - Intergenic
1103131091 12:118469283-118469305 GGTTTCCTCATGTGTAAAAGGGG - Intergenic
1103432516 12:120901162-120901184 TGTTTCTTCCTCTGTGAAACAGG + Intronic
1103455091 12:121059322-121059344 GGTCTCTTCCTCTCTAAAACCGG - Intergenic
1103596715 12:122028706-122028728 TGTTTCTGCATCTGTAAAAAGGG + Intronic
1103688108 12:122748845-122748867 TGTTTCCTCCTGTGTAAAACAGG + Intergenic
1103880423 12:124161818-124161840 TGTTTCTCCATCTGTAAAACTGG - Intronic
1103910210 12:124348087-124348109 GGTTTCCCCATCTGTAAAACGGG + Intronic
1104072912 12:125362057-125362079 TGTTTCTTCATCTGTAAAACAGG - Intronic
1104748368 12:131223607-131223629 GGTTTCTCCTTCTGTACAACGGG - Intergenic
1104977605 12:132559279-132559301 GGTTTCTCCCTCTGTGAAACGGG - Intronic
1105600801 13:21885297-21885319 GGTTTCTTTATCTGTAAAACAGG + Intergenic
1105738681 13:23299082-23299104 AGTTTCTGCCTTTATAAAATGGG - Intronic
1106388362 13:29310212-29310234 TGTTTCCTCCTGTGTAAAATAGG - Intronic
1106415889 13:29545448-29545470 TGTTTCTACGTGTGTAAAATGGG + Intronic
1107059781 13:36146930-36146952 GGTTTCCTCATTTGTAAAACTGG - Intergenic
1107177246 13:37413375-37413397 GGATACTGCCTGGGCAAAACAGG - Intergenic
1107447216 13:40480064-40480086 AGTTTCTCCCTCTGTAAAATAGG + Intergenic
1107521425 13:41185996-41186018 GTTTTCAGCCTGTGAAAAAGGGG - Intergenic
1108002163 13:45914029-45914051 GGTTTCTTCATCTGTAAAACTGG - Intergenic
1108028984 13:46208461-46208483 GGTTTCCTCATTTGTAAAACTGG - Intronic
1108619182 13:52164557-52164579 GGTTTCTGCCTCTGAGAAAAAGG - Intergenic
1108756770 13:53512618-53512640 GTTTTCTTCATGTGTAAAATGGG + Intergenic
1109088781 13:58011696-58011718 GGGCTCTCCATGTGTAAAACAGG + Intergenic
1109112734 13:58343808-58343830 GGTTTTTTTCTGTGAAAAACTGG + Intergenic
1110153593 13:72285557-72285579 GGTTTCTACATCTGTAAAAGGGG - Intergenic
1111966846 13:94869939-94869961 GGTTTCTTCATCTGTAAAATGGG - Intergenic
1112175351 13:97017869-97017891 GTTTTGTGCCTTTGTACAACTGG + Intergenic
1113807945 13:113120910-113120932 AGTTTCCTCATGTGTAAAACAGG + Intergenic
1113910654 13:113839754-113839776 TTCTTCTGCCTGTGTAAAGCTGG - Exonic
1114340192 14:21735372-21735394 GGTTTCTTCATCTGTAAAATGGG - Intergenic
1114734960 14:25034652-25034674 GGTTTCTGACTCTGTAAAACAGG + Intronic
1114833504 14:26175060-26175082 CGTTTCTGCTTCTGTAAAATGGG - Intergenic
1115488380 14:33935137-33935159 GGTTTCTTCATCTGTAAAATGGG + Intronic
1115817089 14:37175402-37175424 AGTTTCCTCCTTTGTAAAACAGG - Intergenic
1116060369 14:39916760-39916782 GGTTTCTGCATCTGTAAAATGGG + Intergenic
1117027347 14:51635082-51635104 GGTCTCTGCCTGCTTAATACTGG - Intronic
1117099104 14:52327411-52327433 GGCATCTGACTGTGTAGAACAGG - Exonic
1117276199 14:54196372-54196394 TGTTTCTTCATCTGTAAAACGGG - Intergenic
1117878153 14:60278011-60278033 AGTTTCTTCATGAGTAAAACAGG + Intronic
1118434261 14:65755190-65755212 AGTTTCTTCATGTGTAAAAAAGG - Intergenic
1118753654 14:68823314-68823336 AGTTTCTTCATCTGTAAAACAGG - Intergenic
1119844549 14:77818818-77818840 AGTTTCTTCGTTTGTAAAACAGG - Intronic
1119846783 14:77836440-77836462 AGTTTCTTCATCTGTAAAACAGG - Intronic
1120779915 14:88478079-88478101 TGTTTCTTCATCTGTAAAACAGG + Intronic
1121102370 14:91258733-91258755 GGTTTCTGCTTCTTTAAAATGGG + Intergenic
1121241581 14:92434231-92434253 ATTTTCTGCTTTTGTAAAACAGG + Intronic
1121256807 14:92536830-92536852 GGTTTCTTCCTCTCTAAAATGGG + Intronic
1121445433 14:93975654-93975676 GGGTTCTGCATGTGAAAAATGGG - Intronic
1121565448 14:94906140-94906162 GGTTCCTTCCTCTTTAAAACAGG + Intergenic
1122021257 14:98839840-98839862 GGTTTCCCCATCTGTAAAACAGG + Intergenic
1122361632 14:101170513-101170535 GGTTTGTTCCTGTGTGAAAATGG + Intergenic
1125010089 15:34862409-34862431 AGTTTCTCCATTTGTAAAACGGG + Intronic
1125013488 15:34906343-34906365 GGTTTCTCACTGTGTCACACAGG - Intronic
1125544373 15:40491591-40491613 GGTTTCTGGATGTGTAGAACGGG + Intergenic
1125754822 15:42056441-42056463 AGTTTCTTCCTTGGTAAAACAGG + Intergenic
1127019748 15:54733198-54733220 TGTTTCTCCCTCTGTAAAATGGG - Intergenic
1127714995 15:61641328-61641350 AGTTTCCTCCTGTGTAAAACTGG - Intergenic
1127969716 15:63948874-63948896 GGTTTCTTCATCTGTAAAACTGG - Intronic
1128074378 15:64817068-64817090 GGTTTCTTTCTGTGCAAAATAGG + Intronic
1128090080 15:64913229-64913251 TGTTTCTTCCATTGTAAAACTGG - Intronic
1128312496 15:66640078-66640100 TGTTTCTTCCTGTGTACAAGAGG - Intronic
1128328993 15:66743377-66743399 GGTTTCTGCATCTGTAAAATGGG + Intronic
1128369426 15:67029524-67029546 AGTTTCTGCATCTGTAAAATGGG - Intergenic
1128382426 15:67122844-67122866 AGTTTCTTCATCTGTAAAACAGG + Intronic
1128451658 15:67809321-67809343 AGTTTCTTCATCTGTAAAACGGG - Intergenic
1128578574 15:68792822-68792844 GGCTTCTGCCTCTGTAGAAAGGG + Intronic
1128617190 15:69119401-69119423 ACTTTCTGCCTTTGTAAAATAGG + Intergenic
1129228338 15:74182634-74182656 AGTTTCTTCCTCTGTAAAATGGG + Intronic
1129888895 15:79058062-79058084 AGTTTCTGCAGCTGTAAAACAGG - Intronic
1130090303 15:80815250-80815272 GGTTTCTTCATCTGTAAAATGGG + Intronic
1130313462 15:82774475-82774497 GGTTTCTTCATCTGTAAAAATGG - Intronic
1130675797 15:85950926-85950948 TGTTTCTTCCTCTGTAAAATGGG - Intergenic
1131174855 15:90203030-90203052 GATTTCTTCATCTGTAAAACAGG + Intronic
1131423303 15:92325603-92325625 GGTTTCCTCATGTGTAAAATGGG - Intergenic
1131685385 15:94761999-94762021 GGTTTCTGCGTCTGTAGAATGGG - Intergenic
1131847587 15:96504152-96504174 TGTTTCTTCCTGTGTAAAGTAGG + Intergenic
1133024570 16:2982474-2982496 AGTTTCTGCGTGTGTAAAATGGG + Intergenic
1133509823 16:6446627-6446649 GGTTTCTTCATCTGTAAAATGGG + Intronic
1133620054 16:7517930-7517952 GGTTTCTGCATCTGTAAAATGGG + Intronic
1133750309 16:8720251-8720273 AGTTTCTGCATCTGTAAAATGGG - Intronic
1134023145 16:10935104-10935126 GGTTTCCTTCTCTGTAAAACAGG - Intronic
1134140198 16:11711804-11711826 GGTTTCTCCATCTGTGAAACTGG + Intronic
1134300109 16:12983331-12983353 GGTTTCTCCCTCTGGAAAACGGG + Intronic
1134682595 16:16136787-16136809 AGTTTCTGTATCTGTAAAACGGG + Intronic
1135139459 16:19909116-19909138 AGTTTCTTCCTCTGTAAAATGGG + Intergenic
1135154117 16:20037615-20037637 GGTTTCCTCATGTGTAAAATGGG - Intronic
1135184092 16:20299798-20299820 TGTTTCTCCCTTTGTAAAATGGG - Intergenic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1135572013 16:23557053-23557075 AGTTTCCGCCTCTGTAAAATGGG + Intronic
1135629575 16:24025329-24025351 GGTTTCCTCATCTGTAAAACAGG + Intronic
1135689334 16:24523566-24523588 GGTTTCTTCCTCTGTAAAACAGG + Intergenic
1135743221 16:24994682-24994704 AGTTTCTTCCTCTGTAACACGGG - Intronic
1135968280 16:27053484-27053506 GGTTTCCTCCTCTGTAAAATGGG - Intergenic
1136031050 16:27503414-27503436 GGTTTCTTCTTCTGTAAAATGGG - Intronic
1136275360 16:29176618-29176640 AGTTTCCTCCTCTGTAAAACGGG - Intergenic
1136362721 16:29791108-29791130 GGTTTCTTCGTCTGTGAAACGGG + Intronic
1136557206 16:31014416-31014438 TCTTTATGCCTGGGTAAAACGGG - Intergenic
1136624836 16:31456005-31456027 TGTTTCTTCATCTGTAAAACAGG - Intergenic
1137239934 16:46647693-46647715 AGTTTCTTCATGTGTAAAATGGG - Intergenic
1137433116 16:48434287-48434309 GGTTTCCTCCTGTGTAAAACTGG + Intronic
1137492790 16:48946813-48946835 AGTTGCTGCATGTGTAAAATGGG + Intergenic
1137589387 16:49684497-49684519 GGTTTCTTCATCTGTAAAATGGG - Intronic
1137614405 16:49838335-49838357 GGTTTCCTCCTCTGTAAAATGGG + Intronic
1138196141 16:55053707-55053729 AGTTTCTGCCTCTGTGAAATGGG - Intergenic
1138452880 16:57104234-57104256 AGTTTCTCCCTCTGTAAAATGGG - Intronic
1138510594 16:57506516-57506538 AGTTTCCACCTGTGTAACACGGG - Intergenic
1139416132 16:66812274-66812296 AGTTTCTTCATGTGTAAAATGGG + Intronic
1139734458 16:68975188-68975210 AGTTTCTTCATCTGTAAAACAGG - Intronic
1140945104 16:79760767-79760789 TTTTTCTTCCTGTATAAAACAGG + Intergenic
1141115790 16:81307984-81308006 AATTTCTCCCTCTGTAAAACTGG - Intergenic
1141195518 16:81857844-81857866 GGTTTCTCCATGTGTTAAATGGG + Intronic
1141690699 16:85594670-85594692 GGTTTCTTCCTCTGTAACACAGG + Intergenic
1141889276 16:86915756-86915778 GGTTTCTTCCTTGGTAAAGCAGG + Intergenic
1142079721 16:88142683-88142705 AGTTTCCTCCTCTGTAAAACAGG - Intergenic
1142181568 16:88673592-88673614 GGTTTCTTCATCTGTAAAAGAGG - Intergenic
1143102267 17:4510980-4511002 GGTTTCTTCCTATATAAAATGGG + Intronic
1144006086 17:11100893-11100915 TGTTTCTTCCTTTATAAAACTGG + Intergenic
1144845800 17:18218287-18218309 AGTTTCTTCCTTTGTAAAATGGG + Intergenic
1144857225 17:18276142-18276164 GGTTTCTGCCTCTGTAAAAAGGG - Intronic
1145028645 17:19488111-19488133 GGTTTCTGCATCTGTAAAGTCGG - Intergenic
1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG + Intronic
1145248243 17:21283849-21283871 GGTTTCCCCCTGTGTAGAACAGG + Intergenic
1145784699 17:27586353-27586375 GGTTTTTGCCTGAGCAAAATAGG + Intronic
1146212752 17:30954971-30954993 GGTTTCCTCCTCTGAAAAACAGG + Intronic
1146636135 17:34506619-34506641 GGTTTCTTCCTCTGTAAAACTGG + Intergenic
1146648441 17:34591062-34591084 GGTTTCCACCTCTGTAAGACTGG + Intronic
1147334581 17:39719660-39719682 AGTTTCTGCCTTTGTCAAATGGG + Intronic
1147920644 17:43914760-43914782 GGTTTTTGCGTCTGTAAAATGGG + Intergenic
1148044213 17:44732542-44732564 CATTTCTGCATTTGTAAAACAGG - Intronic
1148670809 17:49408720-49408742 AGTTTCTGCCTGTGTCAAACAGG + Intronic
1148823325 17:50373611-50373633 AGTTTCTTCCTTAGTAAAACAGG - Intronic
1149263934 17:54907532-54907554 AGTTTCTTCCTGTGTAGTACAGG + Intronic
1149980529 17:61307537-61307559 GGTGTCTACCTGTGTAAAATAGG + Intronic
1150625236 17:66837013-66837035 GGTTCCTGACTGTGTGACACTGG + Intronic
1151074528 17:71255877-71255899 GGTTTCTGCCTGTGTCACCATGG - Intergenic
1151231406 17:72687853-72687875 AGTTTCTGCATGTGAAAAATTGG - Intronic
1151701081 17:75742886-75742908 GGTTTCTCCATCTGTAAAATGGG + Intronic
1152237745 17:79147323-79147345 GGTTTCTGCTTCTGTAAAATGGG - Intronic
1155208145 18:23578249-23578271 CGTTTCTGCATCTGTAAAAGGGG - Intronic
1155318726 18:24597350-24597372 AGTTTCTTCCTCTGTAAAATGGG - Intergenic
1156282026 18:35648668-35648690 AGTTTCTCTCTTTGTAAAACTGG + Intronic
1156822397 18:41388777-41388799 AGTTTCTACATGTGTAAAATGGG + Intergenic
1157987474 18:52455491-52455513 GGTTTCTGCATGTGTAACATAGG + Intronic
1158304600 18:56090925-56090947 GGTTTCTTCATTTGTAAAATAGG + Intergenic
1158496237 18:57957418-57957440 GATTTCTGCATTTGTAAAAGAGG - Intergenic
1158620969 18:59032215-59032237 AGTTTCCACATGTGTAAAACAGG + Intergenic
1159052039 18:63429413-63429435 TGTTTCTGCATCTGTAAAATGGG + Intergenic
1159329825 18:66977735-66977757 GTTTTCTCCCTATGTAAAATTGG - Intergenic
1159779463 18:72644363-72644385 GATTTCCTCCTCTGTAAAACTGG + Intergenic
1159799375 18:72878673-72878695 GGCTTTTGCCTGTGGAAAACTGG + Intergenic
1159882714 18:73874426-73874448 GGTCTCTGCATCTGGAAAACAGG - Intergenic
1161151272 19:2711311-2711333 GGTTCCTGCCTTTGTAAAATAGG + Intergenic
1161394088 19:4035480-4035502 TGTTTCTGCATTTGTAAAATGGG + Intronic
1161484249 19:4526115-4526137 GTTTTCCTCCTGTGTAAAACAGG - Intronic
1163538085 19:17889700-17889722 CGTTTCTGCCTCTGCAAAATAGG - Intronic
1163736624 19:18985402-18985424 AGTTTCTTCCTGTGTCAAATGGG - Intergenic
1164918146 19:32068292-32068314 GGTCTTTGCCTGTGTAGACCTGG + Intergenic
1165716168 19:38047072-38047094 AGTTTCCTCATGTGTAAAACTGG - Intronic
1165773968 19:38394441-38394463 AGTTTCCTCCTCTGTAAAACGGG - Intronic
1166097276 19:40548816-40548838 GGTTTCCTCCTCTGTAAAACAGG + Intronic
1166293124 19:41876056-41876078 GGTTTCCCCCTCTGTAAAATGGG + Intergenic
1166338610 19:42123530-42123552 AGTTTCCTCCTCTGTAAAACGGG - Intronic
1166561858 19:43737873-43737895 AGCATCTGCCTGTGTAAAATGGG - Intronic
1166797391 19:45435323-45435345 AGTTTCTCCCTCTGTAAAATGGG - Intronic
1167005928 19:46776640-46776662 AGTTTCTCCATCTGTAAAACGGG - Intronic
1167194511 19:48018628-48018650 AGTTTGTCCATGTGTAAAACTGG - Intronic
1167298601 19:48666127-48666149 GCTTTCTCCCTCTGTAAAATGGG - Intronic
1167714154 19:51130325-51130347 GGTTTCCTGCTCTGTAAAACAGG + Intronic
1167721112 19:51181347-51181369 GGTTACCGCCTGTGTAGACCAGG - Intergenic
1168063081 19:53905003-53905025 GGTGTCTGTCTGTCTAGAACTGG + Intronic
1168373070 19:55852425-55852447 GGTCTCTGCCTGTCTACAACAGG + Intronic
925113414 2:1354986-1355008 GATTTCTTCATGTGTGAAACAGG + Intronic
925164632 2:1708518-1708540 TGTTTCTGCCTCTGTAAAGGAGG - Intronic
925188555 2:1865475-1865497 AGTTTCTGCATCTGTAAAATAGG + Intronic
925499276 2:4486004-4486026 GGTCTCTGCCGCTGGAAAACTGG + Intergenic
925585880 2:5463657-5463679 GTTTTCTGCCAGTTTCAAACAGG - Intergenic
925619626 2:5778917-5778939 AGTATCTGCTTCTGTAAAACTGG + Intergenic
925777348 2:7348077-7348099 AGTTTCTTCCTCTGTAAAATGGG + Intergenic
926441901 2:12897765-12897787 AGTTTCTGCATATATAAAACAGG + Intergenic
927843386 2:26458965-26458987 GGTTTCTTCATGTATAAAATGGG + Intronic
928132014 2:28658799-28658821 GTTTTCTGGCTGTGTAATCCTGG + Intergenic
928278438 2:29922359-29922381 AGTTTCTGCATCTGTAAATCTGG - Intergenic
929557299 2:42933689-42933711 GGTTTCTGCATCTGTAAAATCGG - Intergenic
929675195 2:43919699-43919721 AGTTTCTGCTTGTGAAAAACTGG + Intronic
929700815 2:44161472-44161494 GGTTTCCTCATCTGTAAAACAGG - Intergenic
929874694 2:45786803-45786825 GGTTTCCACCTCTGTAAAACGGG - Intronic
929877105 2:45805930-45805952 CATTTCTTTCTGTGTAAAACAGG - Intronic
929946211 2:46374552-46374574 GGTTTCCTCCTCTGCAAAACAGG - Intronic
929956144 2:46460188-46460210 GGTTTCTGCTTCTGTAAAACGGG - Intronic
930123434 2:47778384-47778406 AGTTTCTACATCTGTAAAACAGG - Intronic
930242830 2:48954027-48954049 AGTTTCTGCATCTGTGAAACTGG + Intergenic
930634703 2:53791444-53791466 GGATTCTGATTGTATAAAACAGG - Intronic
931000579 2:57776465-57776487 AGTTTCTTCCTCTGTAAAACAGG - Intergenic
931658658 2:64535548-64535570 TGTTTCTTCCTCTGTAAAATGGG + Intronic
931855155 2:66295236-66295258 AGTTTCTTTCTGTGTAAAACAGG - Intergenic
932770302 2:74497343-74497365 GGGTTCTGACTTTGTAAAAATGG + Intergenic
933741156 2:85535084-85535106 AGTTTCTTCATCTGTAAAACAGG + Intergenic
935360377 2:102241446-102241468 AGTTTCTTCCTCTGTAAAAAAGG + Intergenic
935844788 2:107154002-107154024 AGTTTCTTTGTGTGTAAAACGGG - Intergenic
936274561 2:111083242-111083264 TGTTTCTTCATGTGTAAAAAGGG + Intronic
937370101 2:121291330-121291352 GGTTTCTTCATCTGTAAAATGGG - Intergenic
937878661 2:126848581-126848603 GGTTTCTGCATGTGAAATGCAGG + Intergenic
938818929 2:134933900-134933922 AGTTTCTGCATCTGTAAAATGGG - Intronic
939340521 2:140889669-140889691 TGTTTCTTCCTGTGTAAAATGGG - Intronic
939507086 2:143058593-143058615 AGTTTCTACATGTGGAAAACTGG - Intergenic
939711400 2:145524780-145524802 GGTTTCTGTCTCTTTAAAACTGG - Intergenic
940525886 2:154813020-154813042 AGTTTCTGCATTTGAAAAACAGG - Intronic
941081562 2:161066913-161066935 AGTATCTTCATGTGTAAAACTGG + Intergenic
941156221 2:161981430-161981452 GGTTTCTTCATCTGTAAAATTGG - Intronic
941606454 2:167603408-167603430 AGTTTCCTCCTGTGTAAAACAGG + Intergenic
942066444 2:172276294-172276316 AGTTTCTCCATGTGTAAAATAGG + Intergenic
943725484 2:191247129-191247151 GGTTTGTGCCTGTGGGACACTGG + Intronic
944220043 2:197294075-197294097 GGTTTCTCCCTATGAAAAATGGG + Intronic
944684041 2:202102460-202102482 AATTTCTTCCTCTGTAAAACAGG - Intronic
944760495 2:202808718-202808740 AGTCTCTGCCTGGGTAATACAGG + Intronic
945807252 2:214504804-214504826 TGTTTCCTCCTGTGTAAAATGGG - Intronic
946187419 2:217988839-217988861 AGTTTCCTCCTCTGTAAAACGGG + Intronic
946225125 2:218260465-218260487 GGTTTTTGCCTGTGTTAAAATGG - Intronic
946486606 2:220106397-220106419 AGTTTCTTCCTCTGTAAAATGGG + Intergenic
946772306 2:223101253-223101275 AGTTACTGCCTCTGTAAAACTGG - Intronic
947061741 2:226174313-226174335 AGTTTCTTCATCTGTAAAACTGG + Intergenic
947063030 2:226188224-226188246 AGTTTCTTCCCCTGTAAAACTGG + Intergenic
947345818 2:229188152-229188174 GGTTTCTTCATCTTTAAAACAGG + Intronic
947410626 2:229835039-229835061 AGTTTCTGCATGTGTAAAATGGG - Intronic
948445507 2:238029766-238029788 GGTTTCCTCCTGTATAAGACAGG + Intronic
948650736 2:239441965-239441987 TGTTTCTTCCTGTGTAAAATAGG - Intergenic
1168916468 20:1492269-1492291 GGTTTCCTCATCTGTAAAACAGG + Intergenic
1168991174 20:2096909-2096931 GGTTTCTTCATCTGTAAAATGGG + Intergenic
1169262292 20:4148154-4148176 AGTTTCTTCATTTGTAAAACAGG - Intronic
1169767610 20:9164936-9164958 TGAGTCTGCCTGTGTAAAAGTGG + Intronic
1170122361 20:12924900-12924922 GGCTTCCACCTGTGTAAAATGGG + Intergenic
1170369881 20:15637238-15637260 AGTTTCTCCGTCTGTAAAACAGG + Intronic
1170574054 20:17649389-17649411 GCTTTCTGCTTCTGTCAAACAGG + Intronic
1170716951 20:18840104-18840126 GGAGTCTGCCTTTGTGAAACAGG - Intergenic
1171142357 20:22754204-22754226 AGTTTCCCCATGTGTAAAACTGG - Intergenic
1171215185 20:23347277-23347299 AGTTACTGCCTCTGTAAAATGGG - Intergenic
1172008913 20:31835150-31835172 AGTTTCTCCCTCTGTAAAACAGG - Intergenic
1172028646 20:31966900-31966922 AGTTTCTGCATCTGTAAAATGGG + Intergenic
1172040540 20:32041595-32041617 AGTTTCTTCCTCTGTAAAATGGG + Intergenic
1172148852 20:32776614-32776636 GGTTTCTCCATCTGCAAAACAGG + Intronic
1172600696 20:36180644-36180666 GGTTTCCTCCTCTGTAAAGCAGG + Intronic
1173023923 20:39290142-39290164 GGTTTCGGCTTCTGTAAAATGGG + Intergenic
1173437137 20:43043519-43043541 GATTTCTTCATTTGTAAAACAGG - Intronic
1173472022 20:43331531-43331553 AGTTTCTTCATCTGTAAAACGGG - Intergenic
1173554350 20:43954888-43954910 AGTTTCTTCCTATGTAAAATGGG + Intronic
1173554673 20:43957452-43957474 TGTTTTTTCCTCTGTAAAACTGG + Intronic
1173759404 20:45546580-45546602 AGTTTCCGCATGTGTAAAATGGG - Intronic
1173868088 20:46325541-46325563 TGTTTCTTCATCTGTAAAACTGG + Intergenic
1173951883 20:46999839-46999861 GGTTTCTTCATCTGTACAACGGG + Intronic
1174106553 20:48166290-48166312 GGTGTCTTCCTCTGTAAAATGGG + Intergenic
1174243760 20:49160122-49160144 TGTTTCCTCATGTGTAAAACAGG - Intronic
1174275197 20:49398580-49398602 GGTTTCTTCATCTGTAAAATTGG - Intronic
1174394708 20:50239863-50239885 AGTTTCCCCCTGTGTAAAATGGG + Intergenic
1174483140 20:50845127-50845149 GGTTTCCTCATCTGTAAAACAGG - Intronic
1174539201 20:51275833-51275855 GGTTTCTTCATCTGTAAAACGGG - Intergenic
1174709410 20:52688973-52688995 AGTTTCTGCATCTGTAAAACGGG - Intergenic
1174846568 20:53948755-53948777 AGTTTCTGCATCTGTAAAATAGG - Intronic
1174962402 20:55173534-55173556 TGGTTCTGCCTGTGGAAAACAGG + Intergenic
1174994462 20:55550520-55550542 GGTTTCTGCCTTTTTAAACCAGG - Intergenic
1175016902 20:55801436-55801458 AGTTTCTTCCTGTGTAAAATGGG + Intergenic
1175130818 20:56788328-56788350 GGTTTCTGCAGCTGTAAAATGGG - Intergenic
1175166872 20:57050196-57050218 GGTTTCTCCCTGTGCAAAACAGG + Intergenic
1175279794 20:57795347-57795369 AGTTTCTGCCTCTGTAAGACGGG - Intergenic
1175375226 20:58519482-58519504 TGTTTCTTCCTCTGTAAAATAGG + Intergenic
1176652460 21:9563447-9563469 TGTTTCTTCCTCTGTAAAATGGG - Intergenic
1176998298 21:15581194-15581216 GGTCTCTGCTTTTGGAAAACTGG - Intergenic
1177562144 21:22770048-22770070 TGTCTCTGGCTGTGGAAAACAGG - Intergenic
1178398334 21:32262127-32262149 AGTTTCTGCATGTGTAAAATGGG + Intergenic
1179496881 21:41777565-41777587 TGTGTGTGTCTGTGTAAAACTGG - Intergenic
1181005577 22:20011988-20012010 AGTTTCTCCATGTGTAAAATGGG - Intronic
1181468156 22:23121524-23121546 AGTTTCTTCATCTGTAAAACAGG + Intronic
1181737610 22:24893847-24893869 GTTTTCTGCATCTGTAAAATGGG + Intronic
1181746379 22:24957565-24957587 AGTTTCTTCCTCTGTAAAATGGG + Intronic
1181980206 22:26760727-26760749 AGTTTCCTCCTCTGTAAAACAGG + Intergenic
1182277842 22:29201699-29201721 GGTTTCTGCATCTGGAAAATGGG - Intergenic
1182757143 22:32689371-32689393 CGTTGCTGCATCTGTAAAACAGG + Intronic
1182923376 22:34100638-34100660 ATTTTCTTCCTTTGTAAAACAGG - Intergenic
1183091642 22:35526272-35526294 GATTTCTCCATCTGTAAAACAGG - Intergenic
1183668473 22:39258221-39258243 GGTTTCTGCTTCTGAACAACGGG + Intergenic
1183864669 22:40694739-40694761 GGTCTCCTCCTGTGTAAAATGGG - Intergenic
1183931833 22:41239813-41239835 GGTTTCCTCCCATGTAAAACAGG - Intronic
1184093088 22:42302497-42302519 GGTTTCTTCCTCTGTGAAAGGGG - Intronic
1184289326 22:43490020-43490042 GGTTTCCTCCTGTGTAAAGATGG - Intronic
1184633236 22:45803154-45803176 GGTTTCCTCCTCTGTAAAATGGG - Intronic
1184647960 22:45906400-45906422 CGTTTCTTCCTCAGTAAAACAGG - Intergenic
1184761977 22:46550078-46550100 TGTTTCTGCCTCTGTAAATGTGG + Intergenic
1185341963 22:50294976-50294998 GCTTTCTGCCTGTTTAAACTAGG + Intronic
949897043 3:8775739-8775761 GGTTTCCTCATCTGTAAAACAGG - Intronic
949924969 3:9033798-9033820 AGTCTCTGCCTCTGTAAAATGGG - Intronic
949987358 3:9551792-9551814 GGTTTCCTCATCTGTAAAACAGG - Intronic
950186761 3:10950271-10950293 TGTTTCTTCCTCTGTAAAATAGG + Intergenic
950479891 3:13237715-13237737 GGTTTCCTCCTCTGTAAAATGGG + Intergenic
950548250 3:13651832-13651854 AGTTTCTGTGTCTGTAAAACGGG - Intergenic
950743692 3:15069768-15069790 AGTTTCTTCCAGTGTGAAACTGG + Intergenic
951003357 3:17590883-17590905 GTTTTCTGCTTGTGTAAATTAGG - Intronic
951506364 3:23449840-23449862 GGTTTCTGCCAGTGAAAAATGGG - Intronic
951542685 3:23797405-23797427 TGTTGCTGCATATGTAAAACTGG - Intergenic
951790354 3:26476140-26476162 AGTTTCTGACTGTGTAAAATTGG + Intergenic
952244753 3:31575145-31575167 AGTTTCTTCATTTGTAAAACAGG - Intronic
952282030 3:31933124-31933146 AGTTTCTCCATGCGTAAAACTGG - Intronic
952888010 3:38023505-38023527 AGTTTCCTCTTGTGTAAAACAGG - Intronic
953080149 3:39609001-39609023 GGTCTCTACCTGTGCAAAACTGG - Intergenic
953126686 3:40097234-40097256 AGTTTCTGCCTTTGTAAAATGGG - Intronic
953499059 3:43415280-43415302 AGTTTCTTCCTCTGTAAAATGGG - Intronic
954182169 3:48890111-48890133 GGTTTAGGCCTCTGGAAAACTGG - Intronic
954271602 3:49514227-49514249 GGTTTCTGCATCTGTAAAGCAGG + Intronic
954428440 3:50456115-50456137 AGTTTCTTCATCTGTAAAACAGG - Intronic
954583593 3:51716768-51716790 TGTTTCTTCATCTGTAAAACGGG - Intronic
954903850 3:54043119-54043141 GGTTTCCTCCTCTGTAAAACGGG - Intergenic
955353118 3:58208810-58208832 GGTTTCTGCCTATGTTTAATGGG - Intronic
955753020 3:62202108-62202130 GGTTTCCTCATCTGTAAAACGGG - Intronic
955927313 3:64020757-64020779 GGTTTCCTCATGTGTAAAACAGG - Intronic
956124853 3:66001568-66001590 AGTTTCCCCCTGTATAAAACAGG - Intronic
956647439 3:71470242-71470264 TGTTTCTTCATCTGTAAAACAGG + Intronic
956657743 3:71568360-71568382 GGGTTCTTCCTCTGTAGAACAGG - Intronic
956772353 3:72537299-72537321 GCTTTCTGCATCTGTAAAATGGG - Intergenic
957187940 3:76967099-76967121 TGTATCTGCGTCTGTAAAACAGG - Intronic
957293024 3:78301675-78301697 GGGTTCTGTCAGTGAAAAACAGG - Intergenic
958726559 3:97912667-97912689 GGTTTCTGCATCTGTGAAATGGG - Intronic
959658031 3:108832268-108832290 GGTTTCTGGCTGAGGACAACTGG - Intronic
960031307 3:113057711-113057733 AGTTTCTTCATATGTAAAACAGG - Intergenic
960426010 3:117508697-117508719 AGTTTCTTCATCTGTAAAACAGG + Intergenic
960690965 3:120346454-120346476 AGTTTCTGCCTCTGAAAAATGGG + Intronic
960702082 3:120449233-120449255 TGTTTCTTCCTCTGTAAAATCGG + Intronic
961000310 3:123369769-123369791 GGTTTCTTTCTATGTAAAATGGG + Intronic
961017685 3:123480308-123480330 TGTTTCTTCCTCTGTAAAATGGG + Intergenic
962680569 3:137795587-137795609 TGTTTTTGCTTGTGTAATACTGG - Intergenic
963764253 3:149317209-149317231 AGTTTCTGAGTCTGTAAAACAGG - Intergenic
963774554 3:149425148-149425170 AGTTTCTTCCTGTGTAAAATGGG + Intergenic
963960572 3:151304731-151304753 CATTTCTGCCTGTATAAAATGGG + Intronic
964363176 3:155920120-155920142 AGTTTCTTCATCTGTAAAACAGG - Intronic
965774257 3:172211704-172211726 GATTTCTGCCTTTGAAAAAGGGG + Intronic
965806072 3:172543133-172543155 GGTTCTTGTCTCTGTAAAACAGG + Intergenic
966522322 3:180887394-180887416 GGTTTTTGCATTTGTAAAATTGG + Intronic
966564703 3:181363518-181363540 AGTTTCTAGCTGTGGAAAACGGG - Intergenic
967975014 3:195029308-195029330 GGTTTCTCCATCTGTAAAATGGG + Intergenic
968137737 3:196231149-196231171 TGTTTCTTCCTTTGTAAAATGGG - Intronic
968260349 3:197317344-197317366 GATTTCTTCATGTGTAAACCAGG - Intergenic
968881824 4:3304570-3304592 GGTTTCCTCATTTGTAAAACGGG + Intronic
969217314 4:5732639-5732661 AGTTTCTGCATCTGTAAAATGGG + Intronic
970195779 4:13548526-13548548 AGTTTCTTCATCTGTAAAACGGG - Intergenic
970394074 4:15647803-15647825 AGTTTCTTCATCTGTAAAACAGG + Intronic
971137347 4:23883576-23883598 AGTGTCTGCATATGTAAAACAGG + Intronic
971903534 4:32695638-32695660 TGTTTCTGCCTGTGAGAAACAGG + Intergenic
972453323 4:39226648-39226670 AGTTTCTTCATCTGTAAAACGGG + Intronic
973671882 4:53228067-53228089 TGTTCCTTCCTCTGTAAAACAGG + Intronic
973723098 4:53744937-53744959 GGTTTCTTCCTGTGCAAATGAGG - Intronic
973934099 4:55825198-55825220 GGTTTCCTCGTCTGTAAAACAGG - Intergenic
974042099 4:56866299-56866321 GGTCTCTGCCTTTGTAATTCTGG - Intergenic
975475745 4:74821402-74821424 GGTTTGTGCCTGTTTCACACTGG + Intergenic
975515165 4:75239469-75239491 AGTTTCTTCATGTGTAAAATGGG - Intergenic
975783515 4:77863868-77863890 AGTTTCTTCCTCTGTAAAATGGG - Intronic
975921122 4:79390124-79390146 AGTTACTGGCTGTGTAAAACTGG + Intergenic
976215391 4:82711018-82711040 GGTTTCTTCATGTGTAAAGTAGG + Intronic
976518444 4:85998818-85998840 GTTTTCTGCCTGCCTAATACTGG + Intronic
976738542 4:88334957-88334979 AGTTTCTTCATCTGTAAAACAGG + Intergenic
977683505 4:99821066-99821088 AGTCTCTTCCTGTGTAAAGCTGG - Intronic
978219931 4:106257782-106257804 GGTTTCTTCATCTGTAAAACTGG + Intronic
978848851 4:113308914-113308936 GATTTCTGCTAGTGTAAAGCTGG - Intronic
979767137 4:124475522-124475544 GGTTTCTGCTGCTGAAAAACAGG - Intergenic
979891513 4:126102089-126102111 GATTCCTGCCTTTGTAAAAAAGG + Intergenic
980178312 4:129373906-129373928 GGTTTCAGTCTGTGGAAAGCAGG + Intergenic
980947544 4:139337450-139337472 AGTTTCTTCATGTGTAAAATGGG + Intronic
981159940 4:141485852-141485874 AGTATCATCCTGTGTAAAACTGG - Intergenic
982016515 4:151159895-151159917 AGTTTCTTCATCTGTAAAACAGG - Intronic
982263931 4:153521130-153521152 TGTTTCTGCATGTGTAGAATGGG + Intronic
982316175 4:154034212-154034234 GGTTTTTGCATTAGTAAAACAGG + Intergenic
984135382 4:175931210-175931232 AGTTTCTTCATGTGTAAAATGGG - Intronic
984588248 4:181587545-181587567 GGTTTCTTCATCTGTAAAACGGG - Intergenic
984621540 4:181958591-181958613 GGTTTCTGCCTGTGTCGAGTGGG + Intergenic
986298330 5:6457665-6457687 AGTTTCTTCCTCTGTAAAATGGG - Intronic
986407283 5:7438677-7438699 AGTTTCTTCATGTGTAAAATGGG + Intronic
986461343 5:7975580-7975602 GATTTCTTCCTCTGTAAAACAGG + Intergenic
987302533 5:16609238-16609260 TGTTTCCTCCTGTGTAAAATGGG + Intronic
987647382 5:20691394-20691416 GATTGCTGCCTGTGAGAAACAGG + Intergenic
987925598 5:24336909-24336931 GGTTTCTGCATCTTTAAAATGGG - Intergenic
988619085 5:32804136-32804158 AGTTTCTGCCTTTGTACAACTGG + Intergenic
988908189 5:35811568-35811590 GGTGTCTGCATCTGTAAAATAGG + Intronic
989113140 5:37926763-37926785 AGTTTCTTCCTCTGTAAAATGGG - Intergenic
989131181 5:38107746-38107768 TGTTTCCTCCTCTGTAAAACAGG + Intergenic
989156499 5:38349486-38349508 AGTTTCTTCCTCTGTAAAACAGG - Intronic
989199212 5:38746981-38747003 GGTTTCCAACTCTGTAAAACAGG - Intergenic
989580466 5:43028373-43028395 GGTCTCTGCCTGTGTGACATGGG + Intergenic
990539724 5:56760338-56760360 AGTTTCTTCATTTGTAAAACAGG - Intergenic
991027304 5:62044030-62044052 GCTTTGTTCCTCTGTAAAACAGG + Intergenic
993166807 5:84366382-84366404 GGTTTTCTCATGTGTAAAACGGG - Intronic
993654400 5:90559235-90559257 TTTTTCTGCCTGTTTGAAACCGG + Intronic
993822901 5:92642615-92642637 GGTTTCTGCCTGGGTACTCCAGG - Intergenic
995170516 5:109105960-109105982 AGTTTCCTCATGTGTAAAACGGG - Intronic
995218247 5:109619424-109619446 GGTTTCTTCATCTGTAAAATAGG + Intergenic
996091292 5:119354836-119354858 GGTTTTTGCCTATATAAAATCGG + Intronic
996144604 5:119958614-119958636 AGTTTCTCCATCTGTAAAACTGG + Intergenic
996548719 5:124708051-124708073 AGTTTCTGCTTCTATAAAACAGG - Intronic
996888047 5:128382673-128382695 AGTTTCTGGCTGAGCAAAACTGG - Intronic
997255607 5:132425602-132425624 AGTTTCTACCTCTATAAAACGGG + Intronic
997612813 5:135227039-135227061 ACTTTCTTCCTGTGTAAAAAGGG + Intronic
998042649 5:138962457-138962479 AGTTTCTGCATTTGTAAAACAGG + Intronic
998093724 5:139385119-139385141 GGTTTCTGCATCTGTCAAAGGGG + Intergenic
998114455 5:139525531-139525553 GGTTTCTTCATTTGTAAAAATGG - Intergenic
998459942 5:142302479-142302501 AGTTTCTTCATCTGTAAAACTGG + Intergenic
998488592 5:142525896-142525918 AGCTTCTCCCTCTGTAAAACGGG - Intergenic
998641047 5:144011602-144011624 GGTGTCTGCCTCTGTGCAACAGG - Intergenic
998812239 5:145977897-145977919 AGTTTCTGCATCTGTGAAACAGG - Intronic
998918739 5:147043981-147044003 GGTGTCTGCATCTGTAAAATGGG + Intronic
998942128 5:147296023-147296045 GGTTTCTGCCTCTGTGCACCTGG - Intronic
999178396 5:149648648-149648670 AGTTTCTCCATCTGTAAAACGGG - Intergenic
999225962 5:150024790-150024812 GGTTTCTGTATCTCTAAAACAGG - Intronic
999328114 5:150656093-150656115 AGTTTCTGCTTCTGTAAAATGGG - Intronic
999377880 5:151099437-151099459 GGTTTCCTTCTCTGTAAAACAGG - Intergenic
999775649 5:154811194-154811216 AGTTTCTTCATCTGTAAAACGGG - Intronic
999820011 5:155217407-155217429 TGTTTCTCCCTGTATAAAAAGGG + Intergenic
1000171117 5:158704131-158704153 AGTTTCTGCATCTGTATAACAGG + Intronic
1000388652 5:160700327-160700349 AGTTTCTTCCTCTGTAAAATGGG + Intronic
1000981585 5:167822296-167822318 AGTTTTTGCATGTTTAAAACAGG - Intronic
1001135962 5:169103148-169103170 GGTTTCCACCTCTGTAAAATGGG - Intronic
1001601092 5:172928829-172928851 AGTTTCTGCATGTGTAAAGTGGG + Intronic
1001810152 5:174621477-174621499 AGTTTCTTCATCTGTAAAACAGG - Intergenic
1001859764 5:175043908-175043930 AGTTTCTTCATGTGTAAAACAGG - Intergenic
1002057474 5:176606841-176606863 TGTTTCTTCCTCTGGAAAACAGG - Intronic
1002062052 5:176630833-176630855 AGTTTCCTCCTCTGTAAAACAGG + Exonic
1002332175 5:178450800-178450822 GGTTTCTCCATCTGTAAAACAGG - Intronic
1002796365 6:474179-474201 AGTTTCCTCCTGTGTAAAATGGG + Intergenic
1003850062 6:10212747-10212769 GGTTTCCTCATCTGTAAAACTGG - Intergenic
1004316920 6:14597463-14597485 CGTTTTTGCCTGTTTAAAATGGG - Intergenic
1006782861 6:36643845-36643867 AGTTTCTTCATCTGTAAAACAGG + Intergenic
1006913816 6:37581906-37581928 AGTTTCTTTCTGTGTAAAATGGG - Intergenic
1007395193 6:41573744-41573766 CGTTTCTTCCTCTGCAAAACTGG - Intronic
1007949847 6:45861488-45861510 GGTTTCTGCAGCTGTAAAACAGG - Intergenic
1008089342 6:47277573-47277595 AGTTTCTTCATGTGTAATACAGG - Intronic
1008487607 6:52052782-52052804 GGTTTCTTCATCTGTAAAATGGG - Intronic
1009879321 6:69545436-69545458 TGTTTCTCCCCATGTAAAACAGG + Intergenic
1010778013 6:79908984-79909006 AGTTTCTGCTTGGGTCAAACAGG + Intergenic
1011425310 6:87222425-87222447 TGTTTGTGGCTGTGAAAAACTGG + Intronic
1011952547 6:92984790-92984812 GCTTTCTGCCAGTGGAAGACTGG - Intergenic
1012471239 6:99574869-99574891 AGTTTCTTCATCTGTAAAACAGG + Intergenic
1012678720 6:102152122-102152144 GGGTTTTGCCTGTGAGAAACAGG - Intergenic
1013576173 6:111484548-111484570 AGTTTCTACATATGTAAAACGGG + Intergenic
1014055120 6:117005260-117005282 AGTTTCTTCCTCTGTAAAATGGG - Intergenic
1015686621 6:135870363-135870385 AGTTTCTGCATTGGTAAAACTGG + Intronic
1016000991 6:139040985-139041007 GGCTTCCTCCTGTGTAAAATGGG - Intronic
1016459012 6:144262636-144262658 GGTTTCTTCATCTGTAAAATGGG - Intergenic
1017235528 6:152113838-152113860 AGTTTCTTCCTCTGTAAAATGGG - Intronic
1017733531 6:157339508-157339530 AGTTTCTTCCTGTGTCAAATGGG - Intergenic
1017787758 6:157770362-157770384 GTTGGCTGCCTGAGTAAAACAGG + Intronic
1017954028 6:159163348-159163370 AGTTTCTGCCTCTGTAAAATGGG + Intergenic
1019499674 7:1358671-1358693 GGTCTCTGCCTGTTTAACTCGGG - Intergenic
1019653036 7:2170920-2170942 TGTTTCTGCCTGTGTTTAACTGG - Intronic
1019907290 7:4074427-4074449 GGTTTCTTCCTTTGTGAAATAGG + Intronic
1020282878 7:6659294-6659316 GGTTTCTTCATCTGCAAAACAGG - Intergenic
1020886764 7:13828053-13828075 TGTTTCTGACTGTACAAAACTGG - Intergenic
1022263129 7:28726611-28726633 ATTTTCTTCCTGTGTAAGACTGG + Intronic
1022590481 7:31656329-31656351 AGTTTCTTCCTCTGTAAAATAGG + Intronic
1023086299 7:36573010-36573032 TGTTTCTGCATCTGTAAAATGGG - Intronic
1023309989 7:38876456-38876478 GGTTTCTTCCTCTGTAGAATGGG + Intronic
1023574394 7:41610276-41610298 GCTTTCTGCCTCTATAAAATGGG + Intergenic
1024249793 7:47497432-47497454 AGTTTCTTCCTCTATAAAACAGG - Intronic
1028021109 7:85774332-85774354 GGTTTCATCATGTGTAAAACTGG + Intergenic
1028170891 7:87594253-87594275 AGTTTCTTCATGTGTAAAACTGG + Intronic
1028409386 7:90511816-90511838 GGTTTCTTCATCTGTAAAATAGG + Intronic
1028577350 7:92366756-92366778 GGTATCTCCCTCTGTAAAATCGG - Intronic
1029221731 7:98995606-98995628 GGTTTCTTCCTCTGTCAAACAGG + Intronic
1029281907 7:99440810-99440832 TGTTTGTGCCTGTGTCAAATAGG - Intronic
1030096307 7:105903254-105903276 AGTTTCTTCCTTTGTAAAATGGG + Intronic
1031083540 7:117280703-117280725 AGTTTCCTCCTGTGCAAAACTGG + Intronic
1032761767 7:134950105-134950127 AGTTTCTTCATCTGTAAAACAGG - Intronic
1034051948 7:147993197-147993219 GGTTTTTGCCTTTGTTAAAATGG - Intronic
1034222328 7:149455966-149455988 GGTTTCTTCTTGTGGAACACTGG + Exonic
1035162339 7:156960508-156960530 AGTTTCCCCCTCTGTAAAACAGG + Intronic
1035816812 8:2550162-2550184 AGTTGCTTCCTCTGTAAAACAGG + Intergenic
1035872577 8:3151958-3151980 GGTTTCTTCATGTGTAAGAGGGG - Intronic
1036145154 8:6248162-6248184 TGTGTCTGCCTGTCTGAAACAGG + Intergenic
1036986597 8:13538675-13538697 TGTTTCTCCATCTGTAAAACCGG - Intergenic
1038411711 8:27364090-27364112 GGCTTCTTTCTCTGTAAAACGGG - Intronic
1038464937 8:27753186-27753208 TGTTTCTGCATCTGTAAAAGGGG - Intronic
1039610757 8:38917530-38917552 AGCTTCTGCATCTGTAAAACGGG - Intronic
1039717250 8:40123142-40123164 GGTTTCTGTGTGTGTAAAAAAGG - Intergenic
1039798648 8:40935996-40936018 GGTGTCTCCTTGTGTGAAACGGG - Intergenic
1039908988 8:41809460-41809482 AATTTCTCCCTTTGTAAAACAGG - Intronic
1039922648 8:41904137-41904159 GGTTTCTGCCTGGGTTAACTGGG - Intergenic
1040560534 8:48519880-48519902 AGTTTCTTCATATGTAAAACTGG + Intergenic
1040569776 8:48597510-48597532 AGTATTTGCCTGTGAAAAACAGG + Intergenic
1040593951 8:48819955-48819977 GGTTTCCACATGTGTGAAACTGG - Intergenic
1040916355 8:52569358-52569380 GGGTTCTGGGTTTGTAAAACTGG + Intergenic
1041330710 8:56720700-56720722 AGTTTATGCCTATGTACAACAGG + Intergenic
1041361395 8:57058120-57058142 AGTTTCCTCCCGTGTAAAACAGG + Intergenic
1042576481 8:70225889-70225911 TGTTTCTTCATTTGTAAAACTGG + Intronic
1043506631 8:80909229-80909251 GGTTTCTGCCTCAGGAAAGCTGG + Intergenic
1043546134 8:81317843-81317865 GGTTACTGCATGTATAAAATTGG - Intergenic
1043642822 8:82478308-82478330 TCTTTCTGCCTTTGAAAAACTGG + Intergenic
1044739053 8:95306814-95306836 AGTTTCTTCATGTGTAAAATTGG + Intergenic
1044868944 8:96599643-96599665 GGTTTCTTCATTTGTAAAATGGG - Intronic
1045286580 8:100796864-100796886 AGTTTCTTCATGTGTAAAATGGG - Intergenic
1048192846 8:132306035-132306057 GGTTTCTGCATCTGTAAATTGGG - Intronic
1048270865 8:133026985-133027007 ATTTTCTGCATCTGTAAAACGGG - Intronic
1048291263 8:133183364-133183386 TGTTTCTGCCTCTGTAAAATGGG + Intergenic
1048408008 8:134142641-134142663 GGTTTCTGCATCTGTAAATTGGG - Intergenic
1048498077 8:134951831-134951853 AGTTAATGCCAGTGTAAAACGGG + Intergenic
1049057930 8:140253887-140253909 GGTTTCTTCGTGTGTAAAATGGG + Intronic
1049172066 8:141167575-141167597 GGTTTCCGCATCTGTAGAACGGG + Intronic
1049957867 9:710279-710301 AGTTTCTCCCTGAGTAAAAATGG - Intronic
1049982364 9:916091-916113 TGTTTCTTCATGTGCAAAACTGG - Intronic
1050173468 9:2846310-2846332 AGTTTCTGCATATGTAAAATGGG + Intergenic
1050308397 9:4328727-4328749 AGTTTTTCCCTGCGTAAAACAGG + Intronic
1050506168 9:6351710-6351732 GGTTTCTTAATCTGTAAAACAGG - Intergenic
1050869712 9:10551531-10551553 GAATTGTGCCTTTGTAAAACAGG + Intronic
1051365423 9:16318359-16318381 GGTTTCTGCATCTGTTAAATGGG + Intergenic
1051372266 9:16368706-16368728 AGTTTCTTCCAGTGTAAAATGGG - Intergenic
1051434206 9:17013570-17013592 GGTTTCTTCATCTGTAAAACAGG + Intergenic
1051565978 9:18498635-18498657 AGTTTCTTCATGTGTAAAATGGG - Intronic
1051581683 9:18682900-18682922 GGTTTCCTCCTCTGTAAAATGGG + Intronic
1051607491 9:18929741-18929763 TGTTTCTGCATCTATAAAACTGG - Intronic
1051673076 9:19531827-19531849 GGTTTCTTCATCTGTAAAATGGG + Intronic
1052318889 9:27145563-27145585 AGTTTCCTCATGTGTAAAACAGG - Intronic
1052600001 9:30615218-30615240 GGTGTCTACCTTTGTCAAACAGG + Intergenic
1052748868 9:32468472-32468494 GGGTTCTCCCTGTGTTAACCAGG - Intronic
1053107669 9:35425935-35425957 AGTTTCTTCATGTGTAAAATGGG - Intergenic
1053291800 9:36884999-36885021 GGACTGTGCCTGCGTAAAACTGG - Intronic
1053405367 9:37870600-37870622 AGTTTCTTCCTCTGTAAAATGGG - Intronic
1053566307 9:39256430-39256452 GTTCTCTGGCTGTGTAAAGCAGG - Intronic
1054130841 9:61362583-61362605 GTTCTCTGGCTGTGTAAAGCAGG + Intergenic
1054870831 9:70045747-70045769 GATTCCTTCCTCTGTAAAACGGG - Intronic
1055072276 9:72178925-72178947 GGTCTCTGCCTTTTTAAAGCTGG + Intronic
1055145638 9:72931379-72931401 AGTTTCTTCATCTGTAAAACAGG - Intronic
1057194570 9:93109888-93109910 GGTTTCTTCATTTGTAAAAAAGG - Intronic
1057935376 9:99234133-99234155 AGTTTCCTCCTGTGTAAAATGGG - Intergenic
1058044922 9:100347755-100347777 CGTTTCTGCCTGTTTCAAATGGG + Intronic
1058715588 9:107719512-107719534 TGTTTCTGCCTGTGTGACATGGG - Intergenic
1058773816 9:108264693-108264715 GGTTTTGGCCTGTGTCAAAGTGG + Intergenic
1058943331 9:109834322-109834344 GGTTTCTGCCTGTTACAAAATGG - Intronic
1058998930 9:110328099-110328121 AGTTTCTTCATTTGTAAAACAGG - Intronic
1059291138 9:113224886-113224908 AGTTTTTGCCTTTGTAAAACAGG + Intronic
1059343458 9:113612727-113612749 AGTTTCTTCCTCTGTAAAATGGG - Intergenic
1059417945 9:114173625-114173647 AGTTTCTGCCTCTATAAAATGGG + Intronic
1059426454 9:114223756-114223778 GGTTTCTTCATCTGTAAAATGGG + Intronic
1059454233 9:114389522-114389544 AGTTTCTTCATCTGTAAAACAGG + Intronic
1059517161 9:114906876-114906898 GGTTTCCCCATGTGTAAAACTGG + Intronic
1059685758 9:116634112-116634134 ACTTTCTGCCTGTATAAAATGGG + Intronic
1060187987 9:121575512-121575534 AGTTTCTTCCTCTGTAAAACGGG - Intronic
1060421222 9:123471035-123471057 GGTTTCTTCCTCCGTAAAATGGG + Intronic
1060421818 9:123474703-123474725 GGTTTCTTCCTCTGTAAAATGGG + Intronic
1060724803 9:125999670-125999692 AGTTTCTGCCTCTATAAAATGGG - Intergenic
1061729338 9:132601439-132601461 AGTTTCCTCCTCTGTAAAACAGG + Intronic
1061960881 9:133988484-133988506 GGTTGCTGCCTGTGTTTAATAGG - Intronic
1062372782 9:136248755-136248777 AGTTTCTCCCTCTGTAAAACAGG - Intergenic
1185580421 X:1207571-1207593 AGTTTCTTCCTCTGTAAAAGGGG - Intronic
1186043947 X:5513460-5513482 GGATTCTGCCTGTGCACTACAGG - Intergenic
1186704944 X:12131090-12131112 GGTATGTGCCTGAGCAAAACGGG + Intergenic
1187359751 X:18614465-18614487 GGTTTCCTCATGTGTAAAATAGG + Intronic
1187388847 X:18872738-18872760 TGTCTCTTCCTGTGTAAAATAGG - Intergenic
1187744408 X:22392615-22392637 GGTTTATGTCTGTGCAAAAGTGG + Intergenic
1188652411 X:32647635-32647657 AGTTTCTGCTTCTGTAAAATGGG + Intronic
1189024670 X:37380486-37380508 GGTTTCCTCATCTGTAAAACAGG + Intronic
1189093096 X:38108274-38108296 AGTTTCTTCATCTGTAAAACTGG - Intronic
1189185407 X:39050656-39050678 GCTTCCTGTCTCTGTAAAACAGG + Intergenic
1189300978 X:39952087-39952109 AGTTTCTTCCTCTGTAAAATGGG - Intergenic
1189523303 X:41793255-41793277 AGTTTCTACCTCTGTAAAATGGG - Intronic
1189605650 X:42674933-42674955 AGTTTCTGCATATGTAAAATGGG - Intergenic
1190089357 X:47424195-47424217 AGTTTCTGCATCTGTAAAATGGG + Intergenic
1192184693 X:68939107-68939129 AGTTTCTCCCTCTGTAAAATGGG + Intergenic
1192538422 X:71948313-71948335 AGTTTCTTCATGTGTAAAATGGG + Intergenic
1192850371 X:74949692-74949714 GGTTTCTACCTCTCTAAATCAGG + Intergenic
1193606439 X:83573981-83574003 AGTTTCTTCATGTGTTAAACAGG + Intergenic
1194601125 X:95923102-95923124 GATTAGTGCCTGTGTAAAAAAGG - Intergenic
1194761920 X:97804943-97804965 GGTTTCCTCATTTGTAAAACTGG - Intergenic
1195123314 X:101779672-101779694 TGTTTCTTACTGTGTAATACAGG - Intergenic
1195923728 X:110005102-110005124 GATTTCAGGCTGTGGAAAACCGG + Intronic
1196207300 X:112955445-112955467 AGTCTCTGCCTTTGTAAAATGGG + Intergenic
1196899451 X:120368539-120368561 AGTTTCTGCATCTGTAAAATGGG - Intronic
1198178708 X:134182825-134182847 ATTTTCTGCCAGTGTAAAATAGG - Intergenic
1198243243 X:134805218-134805240 GGTTTCCTCCTGTGAAAAATGGG + Intronic
1198257273 X:134934682-134934704 GGTTTCTTCCCCTGTAAAATGGG - Intergenic
1199053487 X:143264926-143264948 GATTTCTTCCTCTGTAAAAGAGG - Intergenic
1199065452 X:143411800-143411822 GATTTCTGCCTCTGTAAAGAAGG + Intergenic
1201559633 Y:15302342-15302364 AGTTTCTGCATCTGCAAAACGGG - Intergenic
1201575541 Y:15457638-15457660 TGTTTCTTCCTGGGTAAAAATGG + Intergenic