ID: 911553427

View in Genome Browser
Species Human (GRCh38)
Location 1:99312734-99312756
Sequence CAGAAGTAGGAGTAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911553421_911553427 -9 Left 911553421 1:99312720-99312742 CCACAATTTCCAAGCAGAAGTAG No data
Right 911553427 1:99312734-99312756 CAGAAGTAGGAGTAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911553427 Original CRISPR CAGAAGTAGGAGTAGGAGGG AGG Intergenic
No off target data available for this crispr