ID: 911554550

View in Genome Browser
Species Human (GRCh38)
Location 1:99327650-99327672
Sequence AGGTTTTTAGAGATGATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911554550_911554555 21 Left 911554550 1:99327650-99327672 CCAAACATCATCTCTAAAAACCT No data
Right 911554555 1:99327694-99327716 TTTTTTCAAAGTATAGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911554550 Original CRISPR AGGTTTTTAGAGATGATGTT TGG (reversed) Intergenic
No off target data available for this crispr