ID: 911559508

View in Genome Browser
Species Human (GRCh38)
Location 1:99387107-99387129
Sequence GTGTAAACACAGTTGAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911559508_911559511 -1 Left 911559508 1:99387107-99387129 CCTCCATTCAACTGTGTTTACAC No data
Right 911559511 1:99387129-99387151 CCATGATTCTTAATAATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911559508 Original CRISPR GTGTAAACACAGTTGAATGG AGG (reversed) Intergenic
No off target data available for this crispr