ID: 911562575 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:99424452-99424474 |
| Sequence | ATGTTTTAGTAGAAATGTCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 911562575_911562577 | 14 | Left | 911562575 | 1:99424452-99424474 | CCATGACATTTCTACTAAAACAT | No data | ||
| Right | 911562577 | 1:99424489-99424511 | CACCCATGAATAAATAGGATAGG | No data | ||||
| 911562575_911562576 | 9 | Left | 911562575 | 1:99424452-99424474 | CCATGACATTTCTACTAAAACAT | No data | ||
| Right | 911562576 | 1:99424484-99424506 | ATAGACACCCATGAATAAATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 911562575 | Original CRISPR | ATGTTTTAGTAGAAATGTCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||