ID: 911562576

View in Genome Browser
Species Human (GRCh38)
Location 1:99424484-99424506
Sequence ATAGACACCCATGAATAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911562574_911562576 15 Left 911562574 1:99424446-99424468 CCAAAACCATGACATTTCTACTA No data
Right 911562576 1:99424484-99424506 ATAGACACCCATGAATAAATAGG No data
911562575_911562576 9 Left 911562575 1:99424452-99424474 CCATGACATTTCTACTAAAACAT No data
Right 911562576 1:99424484-99424506 ATAGACACCCATGAATAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911562576 Original CRISPR ATAGACACCCATGAATAAAT AGG Intergenic
No off target data available for this crispr