ID: 911562577

View in Genome Browser
Species Human (GRCh38)
Location 1:99424489-99424511
Sequence CACCCATGAATAAATAGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911562574_911562577 20 Left 911562574 1:99424446-99424468 CCAAAACCATGACATTTCTACTA No data
Right 911562577 1:99424489-99424511 CACCCATGAATAAATAGGATAGG No data
911562575_911562577 14 Left 911562575 1:99424452-99424474 CCATGACATTTCTACTAAAACAT No data
Right 911562577 1:99424489-99424511 CACCCATGAATAAATAGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911562577 Original CRISPR CACCCATGAATAAATAGGAT AGG Intergenic
No off target data available for this crispr