ID: 911563169

View in Genome Browser
Species Human (GRCh38)
Location 1:99431049-99431071
Sequence CTCTCCAGGGTATGTGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911563159_911563169 14 Left 911563159 1:99431012-99431034 CCTGACTCTTTTTCATCTCACAG No data
Right 911563169 1:99431049-99431071 CTCTCCAGGGTATGTGGGGTAGG No data
911563162_911563169 -10 Left 911563162 1:99431036-99431058 CCCAACAAACCTTCTCTCCAGGG No data
Right 911563169 1:99431049-99431071 CTCTCCAGGGTATGTGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911563169 Original CRISPR CTCTCCAGGGTATGTGGGGT AGG Intergenic
No off target data available for this crispr