ID: 911578487

View in Genome Browser
Species Human (GRCh38)
Location 1:99606493-99606515
Sequence TGATATGCATATAACATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911578486_911578487 2 Left 911578486 1:99606468-99606490 CCTCATTACACATATTAGGGGAA No data
Right 911578487 1:99606493-99606515 TGATATGCATATAACATCACTGG No data
911578482_911578487 19 Left 911578482 1:99606451-99606473 CCACAGAAGTGAAGTGTCCTCAT No data
Right 911578487 1:99606493-99606515 TGATATGCATATAACATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911578487 Original CRISPR TGATATGCATATAACATCAC TGG Intergenic
No off target data available for this crispr