ID: 911579648

View in Genome Browser
Species Human (GRCh38)
Location 1:99619994-99620016
Sequence GAAGTTTTCCAGCACTCCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911579648_911579650 24 Left 911579648 1:99619994-99620016 CCTACGGAGTGCTGGAAAACTTC No data
Right 911579650 1:99620041-99620063 ATTATTTTCAAAACGATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911579648 Original CRISPR GAAGTTTTCCAGCACTCCGT AGG (reversed) Intergenic
No off target data available for this crispr