ID: 911580540

View in Genome Browser
Species Human (GRCh38)
Location 1:99628704-99628726
Sequence GGGTGTGTGACTTATCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911580540_911580544 12 Left 911580540 1:99628704-99628726 CCCTGCTGATAAGTCACACACCC No data
Right 911580544 1:99628739-99628761 AATCAACTCCAACATCATCTTGG No data
911580540_911580545 13 Left 911580540 1:99628704-99628726 CCCTGCTGATAAGTCACACACCC No data
Right 911580545 1:99628740-99628762 ATCAACTCCAACATCATCTTGGG No data
911580540_911580547 28 Left 911580540 1:99628704-99628726 CCCTGCTGATAAGTCACACACCC No data
Right 911580547 1:99628755-99628777 ATCTTGGGCCTTTCTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911580540 Original CRISPR GGGTGTGTGACTTATCAGCA GGG (reversed) Intergenic
No off target data available for this crispr