ID: 911594944

View in Genome Browser
Species Human (GRCh38)
Location 1:99788831-99788853
Sequence GAGTAGAAACAGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911594944_911594955 25 Left 911594944 1:99788831-99788853 CCCTCCTCATTCTGTTTCTACTC No data
Right 911594955 1:99788879-99788901 CTGACTACTTGGATCAGCAAGGG No data
911594944_911594947 -7 Left 911594944 1:99788831-99788853 CCCTCCTCATTCTGTTTCTACTC No data
Right 911594947 1:99788847-99788869 TCTACTCAAGTATCATATCCAGG No data
911594944_911594949 14 Left 911594944 1:99788831-99788853 CCCTCCTCATTCTGTTTCTACTC No data
Right 911594949 1:99788868-99788890 GGAGACCCTCCCTGACTACTTGG No data
911594944_911594954 24 Left 911594944 1:99788831-99788853 CCCTCCTCATTCTGTTTCTACTC No data
Right 911594954 1:99788878-99788900 CCTGACTACTTGGATCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911594944 Original CRISPR GAGTAGAAACAGAATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr