ID: 911601193

View in Genome Browser
Species Human (GRCh38)
Location 1:99849998-99850020
Sequence CGGCTCCGGGCCGGGGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 259}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911601193_911601206 22 Left 911601193 1:99849998-99850020 CCAGGTCCCCCGGCCCGGAGCCG 0: 1
1: 0
2: 6
3: 33
4: 259
Right 911601206 1:99850043-99850065 GCTCTCGCGAGACTAGCGGTCGG 0: 1
1: 0
2: 0
3: 2
4: 6
911601193_911601205 18 Left 911601193 1:99849998-99850020 CCAGGTCCCCCGGCCCGGAGCCG 0: 1
1: 0
2: 6
3: 33
4: 259
Right 911601205 1:99850039-99850061 CCACGCTCTCGCGAGACTAGCGG 0: 1
1: 0
2: 0
3: 1
4: 18
911601193_911601208 24 Left 911601193 1:99849998-99850020 CCAGGTCCCCCGGCCCGGAGCCG 0: 1
1: 0
2: 6
3: 33
4: 259
Right 911601208 1:99850045-99850067 TCTCGCGAGACTAGCGGTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 6
911601193_911601210 28 Left 911601193 1:99849998-99850020 CCAGGTCCCCCGGCCCGGAGCCG 0: 1
1: 0
2: 6
3: 33
4: 259
Right 911601210 1:99850049-99850071 GCGAGACTAGCGGTCGGGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 50
911601193_911601207 23 Left 911601193 1:99849998-99850020 CCAGGTCCCCCGGCCCGGAGCCG 0: 1
1: 0
2: 6
3: 33
4: 259
Right 911601207 1:99850044-99850066 CTCTCGCGAGACTAGCGGTCGGG 0: 1
1: 0
2: 0
3: 0
4: 10
911601193_911601201 -8 Left 911601193 1:99849998-99850020 CCAGGTCCCCCGGCCCGGAGCCG 0: 1
1: 0
2: 6
3: 33
4: 259
Right 911601201 1:99850013-99850035 CGGAGCCGACTGAGACGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 48
911601193_911601209 27 Left 911601193 1:99849998-99850020 CCAGGTCCCCCGGCCCGGAGCCG 0: 1
1: 0
2: 6
3: 33
4: 259
Right 911601209 1:99850048-99850070 CGCGAGACTAGCGGTCGGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911601193 Original CRISPR CGGCTCCGGGCCGGGGGACC TGG (reversed) Intergenic
900140860 1:1139065-1139087 GGACTCCGAACCGGGGGACCTGG + Intergenic
900162782 1:1232251-1232273 CCGCGCCGGGCCGGCGGCCCAGG - Exonic
900389549 1:2428028-2428050 CAGCTCCGGGCCGAGTGCCCAGG - Intronic
902336853 1:15758953-15758975 GGGCGCCGCGCCGGGGGTCCCGG - Intronic
902518889 1:17004812-17004834 CGGCTCCAGGCTGGGGAAGCAGG + Exonic
903014008 1:20350192-20350214 CTTCTCGCGGCCGGGGGACCTGG - Exonic
903344160 1:22673677-22673699 CAGCTCCTGGCCGGGCTACCCGG + Intergenic
903774755 1:25785621-25785643 GGGCTCTGGGCCAGGTGACCCGG + Exonic
903950542 1:26993807-26993829 CGCCTGCGGCCCGGGGGCCCAGG + Exonic
904236687 1:29121581-29121603 CCGCACCGGGCCGGGGCCCCAGG - Exonic
904368856 1:30035809-30035831 CAACTCAGGGCCGTGGGACCTGG - Intergenic
905108227 1:35576671-35576693 CGGCTTCGGACCGGGGTTCCGGG - Intronic
905137089 1:35808242-35808264 CGGCGCCCGGCCCGGGGACAGGG - Exonic
905789837 1:40784068-40784090 CGGCGCCGGGCTGGGGGCGCCGG - Exonic
905803858 1:40862173-40862195 CTGGCCCGGGCCGGGGGAGCCGG - Exonic
906480872 1:46198246-46198268 CGGCTCCGGGCCCTGGGAGGAGG - Intronic
906680987 1:47725356-47725378 CGGCGCCCGCCCGGGGCACCCGG + Intergenic
911601193 1:99849998-99850020 CGGCTCCGGGCCGGGGGACCTGG - Intergenic
912401468 1:109397455-109397477 GGGCTGCGGCCCGGGGGACGCGG + Intronic
915246466 1:154559052-154559074 CGGCTCGGGGGCGGGGGAAGCGG - Intergenic
916414036 1:164576388-164576410 CGGCGCCGCGCCGGCGGACCGGG - Intronic
916676333 1:167066825-167066847 GGGCTCCGGGACCGGGGACCCGG - Intronic
918044807 1:180935416-180935438 CGGCTCCGGGACGCGGGGCAGGG + Exonic
918078748 1:181190122-181190144 CCGCTGCGGGCTGGGGGTCCGGG - Intergenic
919403268 1:197146486-197146508 CGGCTCCGGAGCGGGGATCCGGG + Exonic
919916945 1:202144665-202144687 CCGCACCGAGCCGCGGGACCCGG - Exonic
920200669 1:204257940-204257962 CTGCTCTAGGCTGGGGGACCTGG - Intronic
920418303 1:205813084-205813106 GGGCACCCGGACGGGGGACCGGG + Exonic
920872598 1:209806355-209806377 CGGCTCAGGGCTGGTGGTCCTGG + Intergenic
922811227 1:228416640-228416662 CGGCCCGGGGCGTGGGGACCTGG + Intronic
922959960 1:229637916-229637938 CTGCTCAGTGCCGGGGGCCCGGG + Exonic
923035974 1:230285400-230285422 CGGCTCTGGGCAGTGCGACCCGG - Intergenic
923674022 1:236064947-236064969 CGGCCCCGGACAGGGGGACCTGG - Exonic
1063568420 10:7192804-7192826 TGACTCAGGGCCGGGGGTCCGGG + Intronic
1064179251 10:13100394-13100416 AGGCTCCGGGCCGCGGGGCAGGG - Intronic
1067781515 10:49210922-49210944 CTGCTCCAGGCCAGTGGACCTGG - Intergenic
1070129672 10:73647753-73647775 AGGCCCGGCGCCGGGGGACCCGG - Exonic
1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG + Exonic
1070741857 10:78908413-78908435 AGGCTCAGGGCCTGGGGCCCAGG - Intergenic
1075673585 10:124281026-124281048 TGGCTCCAGGCTGGGCGACCTGG + Intergenic
1076499366 10:130924328-130924350 CGGCCCCAGGCCGCAGGACCTGG + Intergenic
1076817922 10:132923596-132923618 CTGCTCGAGGCCGGGGGTCCGGG - Intronic
1077140624 11:1022683-1022705 CGGCTCCAGGTCAGGGGACCTGG - Intronic
1077247563 11:1546956-1546978 CGGCTCCGGGTCCGGGGCCTAGG - Intergenic
1077266380 11:1652901-1652923 CGGCTCCGCGCTGGAGAACCGGG + Intergenic
1078180273 11:9004665-9004687 CGTTTCCGAGCCGGGGGAGCAGG + Intergenic
1080802136 11:35618775-35618797 CCGCTCCGGGCCGGGCGCCGTGG - Exonic
1082693432 11:56331994-56332016 CGGGTCAGGGCCGGCGGCCCAGG + Intergenic
1083304415 11:61755119-61755141 CGGCTCTGGGCTGGGAGACTGGG + Intronic
1083457335 11:62787617-62787639 CTGCTCGGAGCCGGTGGACCTGG + Intronic
1083668040 11:64285877-64285899 CGGCTCAGGTCGTGGGGACCCGG - Intronic
1083732050 11:64657671-64657693 GGGCTCCGGGCCAGAAGACCTGG - Intronic
1083993105 11:66258452-66258474 GGGCTGCCGGCTGGGGGACCTGG + Intronic
1084204871 11:67585370-67585392 CAGCTCTGGGCCAGGGGCCCAGG + Intronic
1084215515 11:67645142-67645164 CAGCTCCAGACCTGGGGACCAGG + Exonic
1084684412 11:70685352-70685374 CAACTCCAGGCCAGGGGACCTGG + Intronic
1085053373 11:73390945-73390967 GGGCTCCTGGCTGGGTGACCAGG + Intronic
1085353543 11:75815786-75815808 CGGCCTCGGGCCGGGGCCCCAGG - Intronic
1089966202 11:122656372-122656394 CGGCTCCGGGCGGGGGTGCGGGG + Intronic
1090333401 11:125947825-125947847 CGGCCACAGGCCGGGGAACCAGG - Intergenic
1091550092 12:1530410-1530432 CTGCTCCGGAGCGCGGGACCCGG - Intronic
1094470475 12:30796990-30797012 CAGCTCCGGGCCGGGGGTGGAGG + Intergenic
1096242537 12:49967102-49967124 CTGCCCCGGGCTGGGGGAGCCGG + Intergenic
1097086791 12:56474812-56474834 CTGCTCAGGGCCGAGGGAACAGG - Exonic
1097190301 12:57216509-57216531 GGGCTCCGGGCCCGTGCACCTGG - Intergenic
1101892646 12:108730976-108730998 GGGCTCCAGGCCTGGGGACTGGG - Intronic
1103726175 12:122998376-122998398 CTGCTCCAGGCTGGGGGACTGGG + Intronic
1104930412 12:132336575-132336597 CGGCTCTGCGCCTGGGGCCCGGG + Intergenic
1109284793 13:60397438-60397460 CGGGTGCGGGCCGGGGCCCCAGG + Intronic
1109344637 13:61099959-61099981 CGGGTCCGGACCCTGGGACCAGG - Intergenic
1113312016 13:109140936-109140958 CAGCGCCAGGCCGGGGGACGCGG - Exonic
1113956746 13:114103424-114103446 CGGCTCCCAGACGGGGGACGGGG + Intronic
1115028467 14:28767669-28767691 GGGCGGCGGGCCGGGGGAGCTGG + Exonic
1116186798 14:41608299-41608321 CGGCTCCGCGCCCGGGGAGCGGG - Exonic
1116950184 14:50872217-50872239 CAGCTACGGGCTGGGGGCCCGGG - Exonic
1117963941 14:61188435-61188457 CGGCTCCGGGTCGGGCTCCCAGG + Intronic
1121645750 14:95516423-95516445 CGGCGCGGGGGCGGGGGCCCCGG - Intronic
1122470895 14:101965109-101965131 CGTCTGCGGCCCTGGGGACCCGG - Intronic
1122967365 14:105137669-105137691 CGGCTCTGGGCCAGGGGACCAGG - Intergenic
1124190834 15:27574822-27574844 CGGCTCCCAGCCTGGGGCCCGGG - Intergenic
1124696797 15:31870447-31870469 CGGGGCCGGGCCCGCGGACCAGG - Intronic
1125530553 15:40410638-40410660 CGGCTCCGGCCTGGGCTACCTGG + Exonic
1125609433 15:40960642-40960664 CGGATCCAGGCCTGGGGAACGGG - Intergenic
1125921680 15:43528908-43528930 CGGCGCCGGGTAGGGGGGCCAGG + Exonic
1129483026 15:75843124-75843146 CGGCTCCAGGCCGGGGGCGGGGG + Intergenic
1131056708 15:89379198-89379220 CGGCTGCGGCTCCGGGGACCGGG - Intergenic
1131133159 15:89912848-89912870 CGGCTCTGTGCCGGGGTGCCCGG - Exonic
1132110767 15:99100446-99100468 CTGCTCCGGGCTGGGGAAGCGGG - Intronic
1132397958 15:101488726-101488748 CAGCGCAGGGCCGGGGGTCCTGG - Intronic
1132419308 15:101652093-101652115 CGGCCTCGGGCCGGGCGGCCAGG + Intronic
1132527757 16:426026-426048 CGGCTCCGAGCCCGGGGGCGAGG - Exonic
1132649638 16:1014643-1014665 CGACTCTGGGCCAGGGGAACTGG - Intergenic
1133069308 16:3235241-3235263 CGGCTCCGAACGGGGAGACCAGG - Intronic
1135733870 16:24915673-24915695 CAGCTCCGTGCCGGGAGACAGGG + Intergenic
1136237803 16:28925265-28925287 CGGCCCCGGGCTGGAGGCCCCGG + Exonic
1136539947 16:30923638-30923660 CAGCGCGGGGCTGGGGGACCAGG + Intronic
1136993293 16:35170272-35170294 CGGCTGGGGGCCGGGTGGCCGGG - Intergenic
1138667348 16:58582874-58582896 CTGCTCCGGGCAGTGGGATCTGG - Exonic
1141697633 16:85627676-85627698 CGGATGAGGGCCGGGGGGCCGGG - Intronic
1141765935 16:86060138-86060160 CGGCTCTGGGCCAGGGGTCAGGG - Intergenic
1142277972 16:89132898-89132920 CAGCTCCCGGCCAGGGCACCAGG + Intronic
1142474557 17:181323-181345 CGGCTCGGGGCCCGGCGTCCGGG + Exonic
1143492856 17:7294250-7294272 TGACTCCGGGCCGGGGGGGCGGG + Exonic
1143608486 17:8003981-8004003 GGCCTCCGGGCCTGGGGACAAGG - Exonic
1144606066 17:16666768-16666790 GGGCTCCTGGCAGGAGGACCTGG + Intergenic
1144764230 17:17724217-17724239 CGGCGGCGGGCCGGGGGCTCGGG - Intronic
1144905100 17:18635335-18635357 GGGCTCCTGGCAGGAGGACCTGG - Exonic
1146283356 17:31559220-31559242 CGGCTCCCGGCGGGCGGACGCGG - Intergenic
1147312836 17:39605338-39605360 CGGCGCCGGGCGCGGGGAGCGGG - Exonic
1147393125 17:40122209-40122231 GAGCTCCGGGGCGGGGGGCCGGG + Intergenic
1147429545 17:40363039-40363061 CGGCTCGGGGCCGGGGCGCCGGG + Exonic
1147967164 17:44199612-44199634 CGGCCCCGGGCCCTGGGCCCCGG - Intronic
1148109471 17:45136573-45136595 AGAACCCGGGCCGGGGGACCAGG - Exonic
1148139248 17:45316846-45316868 CTGCTCCGGGGCGAGGGGCCAGG + Intronic
1151559180 17:74861592-74861614 CGGGTCGGGGCCAGCGGACCAGG - Intergenic
1152092462 17:78254535-78254557 CCGCCCTGGGCCGGGGGTCCAGG + Intergenic
1152110884 17:78357294-78357316 GGGCTCGGGGCAGTGGGACCTGG + Exonic
1152212432 17:79009594-79009616 AGGCTCCGGGACGGGGGTCCGGG + Intronic
1152468361 17:80477713-80477735 CGGCGCCGGGCTGGGGGCTCAGG + Intronic
1152544192 17:80992422-80992444 GGGCTCCGGCCCAGGGCACCAGG - Intronic
1152570552 17:81119617-81119639 CGGGGCCGGGCCGGGGTCCCAGG - Intronic
1152748415 17:82051638-82051660 CGGGGCCGGGGCGGGGGTCCGGG + Exonic
1152815271 17:82404188-82404210 CGGCTCCGGGCCCGCGGGGCGGG + Intronic
1153006176 18:500463-500485 GGGCTCTGGGCGGGGGGAACGGG - Intronic
1153226866 18:2906562-2906584 CGGCCCCGGGCAGGGGTCCCCGG + Intronic
1157279106 18:46334197-46334219 CGGCTCCGGGGCGCGGGCGCGGG - Intronic
1160163186 18:76491214-76491236 GGGCTCCGGGCCGGGGCAGGCGG - Intronic
1160512116 18:79458474-79458496 CGGCTCCGGGCGGCGGGTCCTGG + Intronic
1160516111 18:79480092-79480114 CAGCTCCGGGCCAAGGGACCTGG + Intronic
1160557669 18:79736500-79736522 CGGCAGGGGGCCGGGGGCCCAGG + Exonic
1160766922 19:812854-812876 CGGCTACGAGCTGGGGGACCTGG - Exonic
1160897059 19:1407945-1407967 CGGCTTCGCGCCGGGGGCCCTGG + Intronic
1160986858 19:1843152-1843174 CGGCTCTGGGCCCGGGGAGCTGG - Intronic
1160986879 19:1843212-1843234 CGGCTCTGGGCCCGGGGAGCTGG - Intronic
1161030930 19:2057498-2057520 GGGCTCCAGGGTGGGGGACCCGG - Intergenic
1161099895 19:2416383-2416405 CGGCTCCAGGGAGGAGGACCAGG - Intronic
1161101874 19:2425501-2425523 CCGCCCCGGCCCAGGGGACCAGG + Intronic
1161955055 19:7489058-7489080 CGGGGCCAGGCCGGGGTACCGGG + Intronic
1163508040 19:17719727-17719749 GGGCTCCGGGGCGGGGGTCGCGG + Intronic
1163597065 19:18226370-18226392 GGGAGCCGGGCCCGGGGACCGGG + Intronic
1163807237 19:19406402-19406424 CCGCTCAGGGGCGGGGGTCCGGG + Intronic
1165879468 19:39032174-39032196 CGGCTCCGGCGCGGGGACCCGGG + Exonic
1167463853 19:49640040-49640062 CGGCCCCGGGGCGGGGGACCTGG - Exonic
1167630857 19:50625619-50625641 GGGCTCGGGGCCTGGGGTCCTGG - Intronic
1168343814 19:55641061-55641083 CAGCTCCGGGCCGGCGGCGCCGG - Intronic
1168615517 19:57834048-57834070 GGGCTCCGAGCCAGGGGACCTGG - Intronic
1168621268 19:57881399-57881421 GGGCTCCGAGCCAGGGGACCTGG + Intronic
925984738 2:9206744-9206766 CGGGTCCGGGCCGGGGGCGGCGG - Exonic
927154102 2:20211980-20212002 CGGCTCCCGTGCTGGGGACCTGG + Intronic
927751325 2:25673276-25673298 CTGCGCCGGGACTGGGGACCCGG - Intronic
927991922 2:27454004-27454026 CTGCTCCGGGCCCAGAGACCAGG - Exonic
928149256 2:28811145-28811167 GGGCTCTGGGCTGAGGGACCTGG + Intronic
928436055 2:31255123-31255145 CAGCTCCGGGCCTGGAGACTGGG - Intronic
931644058 2:64405623-64405645 TGGCTTCGGGCCTGGTGACCCGG - Intergenic
932191137 2:69742191-69742213 GGGCTCCGGGCCGGGGGTCCTGG + Intronic
932887487 2:75560729-75560751 CGGGGCCGAGCAGGGGGACCCGG + Intronic
937226885 2:120375326-120375348 AGGCTCTGGGCCTGGGGACTGGG - Intergenic
937438904 2:121900666-121900688 GGGCCCAGGGGCGGGGGACCAGG + Intergenic
938104540 2:128520990-128521012 CGTCTCCAGGCCTGGGGACCTGG + Intergenic
938133702 2:128737100-128737122 CGCCTCCGGGCGGGGGTCCCCGG + Intergenic
939629451 2:144516079-144516101 CGGCCCCGCGCCGGGTGATCGGG + Intronic
942314298 2:174683250-174683272 CGGCTGCTGGCGGGGGGATCGGG + Intergenic
943060431 2:183037742-183037764 CGGCTCCCGGCGGCGGGATCGGG - Intronic
944069983 2:195657529-195657551 CTGCTGCGGGCCGCGGGATCGGG + Intronic
944413476 2:199463086-199463108 CGGCCGCGGGCCGGGGGACCGGG + Intronic
946400516 2:219466168-219466190 CGGGTCCGGGCCGGCAGGCCTGG - Intronic
948393417 2:237627855-237627877 CGGCTCCAGGCGGGTGGGCCGGG + Intronic
948840492 2:240646477-240646499 CGGCTTCGGGCTGGGTGTCCTGG + Intergenic
948912192 2:241010255-241010277 TGGCTCAGGTCCGGGGGAGCAGG + Intronic
1169214739 20:3786524-3786546 CCGCCCCGGGGCGGGGGGCCCGG + Exonic
1170578360 20:17681226-17681248 GGGCTCCCGGCGGGGGGACGAGG - Intronic
1170889804 20:20367873-20367895 CGGCGCCGGGCGGGGCGACCAGG + Intergenic
1172581327 20:36050877-36050899 CGGCCCGGGGCCGGAGGGCCTGG + Intergenic
1173495485 20:43514785-43514807 CAGCTCAGGGCCTGGGGAGCGGG - Intronic
1175873713 20:62219988-62220010 CGGCTCCGGGACGCGGGGCAGGG + Exonic
1175877901 20:62238908-62238930 GGGGGCCGGGCCGGGGGTCCCGG - Intronic
1175963457 20:62648444-62648466 GGGCTCCGGGCCTGGGCACATGG + Intronic
1175999454 20:62825455-62825477 CACCTGCAGGCCGGGGGACCAGG + Intronic
1176125360 20:63472541-63472563 CGGCTCCCGGCCGGGGGGCCTGG - Exonic
1179561735 21:42219722-42219744 CGGCTGTGGGCTTGGGGACCGGG + Intronic
1180559262 22:16602122-16602144 GGGCTCGGGGCCGGGGCTCCAGG - Intergenic
1180921652 22:19524468-19524490 CTGCTTCGGGCCGGGGGGCCGGG - Exonic
1180949477 22:19714715-19714737 CGGGTCCGGGCCGGCGGGCGGGG - Intronic
1180963567 22:19773853-19773875 CGGCTGAGGGCCGAGGGGCCAGG - Intronic
1181026741 22:20131522-20131544 CGGCTCCGCGGCCCGGGACCAGG + Intronic
1181395543 22:22618642-22618664 CAGCCCCGGGCTGTGGGACCAGG + Intergenic
1181782081 22:25200850-25200872 AGGCTCTGGGCTGGGTGACCAGG - Intronic
1183161265 22:36114865-36114887 TGGCTCTGGGCCTGGTGACCAGG + Intergenic
1183601647 22:38843688-38843710 CCGCTGCGGGCCCGGGGACGCGG + Exonic
1184131574 22:42519686-42519708 GGGCTCCGGGACGCGAGACCGGG - Intronic
1184769463 22:46589079-46589101 CGGCAGGGGGCGGGGGGACCTGG + Intronic
1185316075 22:50179659-50179681 TGGCTCTGGGCTGGGGGAGCTGG - Exonic
1185386031 22:50531669-50531691 CGGCCCCGGGCCAGGCCACCTGG - Exonic
1185398444 22:50604198-50604220 CGGCTCCGAGGCGGGCGACGAGG - Exonic
1185409108 22:50673478-50673500 CCGCTCAGGGCTGGGGGGCCTGG + Intergenic
953350219 3:42209822-42209844 CCACACCGGGCCGGGGGTCCAGG - Exonic
953492517 3:43363558-43363580 AGCCTCCGGGCAGGGGGATCAGG - Intronic
956761369 3:72447439-72447461 CGGCTTCGGGGCCGGGGTCCCGG - Intergenic
960970338 3:123134900-123134922 CGGCTCCTGGCCTTGGGTCCAGG - Intronic
961754789 3:129121456-129121478 GGGCCCAGGCCCGGGGGACCCGG - Exonic
963133308 3:141877221-141877243 CGGCTTCGGGCAGGGGTCCCCGG - Intronic
967055447 3:185825463-185825485 CGGCCCCGGGCTGGGGCTCCGGG + Intergenic
967859486 3:194140889-194140911 CGGATGCGGGCCGCGGGCCCCGG + Intergenic
968114804 3:196081606-196081628 CGGCTCCGGGCTGCGGGTCCGGG - Intronic
968372783 4:11132-11154 CGGCGCCGGGGCGGGGGTCGGGG + Intergenic
968372796 4:11181-11203 CGGCGCCGGGGCGGGGGTCGCGG + Intergenic
968519713 4:1029887-1029909 AGGCTGGGGGCTGGGGGACCGGG + Intergenic
968574889 4:1361048-1361070 CAGATGCGGGCCGGGGGTCCTGG - Intronic
968820136 4:2843920-2843942 CTGCTGCGGGCCAGGGGACGGGG + Exonic
968949830 4:3684692-3684714 TGGCTCTGGGCCGGACGACCTGG - Intergenic
969053327 4:4387303-4387325 CGGCCCCAGGACCGGGGACCGGG + Intronic
969656075 4:8499279-8499301 CGGCCCAGGGCAGGGGGCCCAGG - Intergenic
973996829 4:56467300-56467322 CGGCCCCGCACCGTGGGACCAGG + Exonic
977693763 4:99946240-99946262 CGGCTCCGGGCTGGGGCTCGGGG - Intronic
978954591 4:114598699-114598721 CGGCTGGGGGGCGGGGGGCCTGG + Exonic
979278102 4:118835851-118835873 CGGCGCCCGGCCCGGGGACGCGG - Intronic
979624273 4:122827588-122827610 CGGCTCCGGGCCGGGGGTACTGG - Intronic
981550270 4:145936577-145936599 CGGCTGCGGCCCGGGTGACACGG + Intronic
985462611 4:190121434-190121456 CGGCGCCGGGGCGGGGGTCGGGG - Intergenic
988482037 5:31639191-31639213 CGGCCCCGGGCAGCGGGACGCGG + Intergenic
992690364 5:79235935-79235957 CGGCTCCAGCCCCGGGGAACTGG + Intronic
996311151 5:122107310-122107332 CGGGTTGGGGTCGGGGGACCTGG + Intergenic
997235096 5:132268052-132268074 AGGCTCAGGGCCGGTGGGCCTGG + Intronic
998963042 5:147509231-147509253 CGGCTCCAGGCAGGGGAACCCGG + Intronic
999322597 5:150624707-150624729 CGGCTCCCAGCCCGGGGTCCCGG + Intronic
1001332256 5:170770622-170770644 CGGCTAAGGGCTGGGGGACAGGG + Intronic
1002046318 5:176543446-176543468 CGGGGCCGGGGCGGGGGTCCTGG - Intronic
1002322426 5:178383654-178383676 CAGCTCCAGGCCGAGGGCCCAGG - Intronic
1002360678 5:178668234-178668256 CGGCTGGGGGCAGGGGGAGCAGG + Intergenic
1002645332 5:180649781-180649803 CGGCTCCGGGCGCGGGGACGCGG + Intergenic
1002714412 5:181217523-181217545 CGGCTTCGGGCCGTGGGACGCGG - Intergenic
1003084961 6:3053693-3053715 CGGCTCCGCCCTGGGGGACCAGG + Intergenic
1003092870 6:3118812-3118834 CGGGTCCGGCCCGTGGGACGTGG - Exonic
1003645410 6:7910240-7910262 CGGCTCGGGGCCGGGAGCCGGGG - Intronic
1004924087 6:20402489-20402511 CTGCTCCGCGCCGGGGGCACTGG - Exonic
1006152468 6:31996758-31996780 TGGCTAAGGGCCAGGGGACCAGG + Intronic
1006158774 6:32029495-32029517 TGGCTAAGGGCCAGGGGACCAGG + Intronic
1006535614 6:34696656-34696678 CGCCGCCGGGCCCGGGGACCTGG + Exonic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1006787576 6:36678829-36678851 CGGCTCTGGGCCGCCGGCCCGGG - Exonic
1006806384 6:36792288-36792310 CAGCTCCAGGCTCGGGGACCCGG - Intronic
1007327654 6:41073808-41073830 CGGCGCCGGGCCGGAGACCCGGG - Intronic
1007774979 6:44219788-44219810 CGGGGCGGGGCCGGGGGGCCTGG + Intronic
1012912875 6:105137127-105137149 CGGCTGCGGGCTTGGGGACCCGG - Exonic
1013170902 6:107635394-107635416 CAGCGCCGGGCCTGAGGACCTGG + Exonic
1016340856 6:143060599-143060621 CGCCTCCTGGCCGGGTGTCCCGG + Intronic
1017877429 6:158536495-158536517 CGGGTGGGGGCTGGGGGACCCGG - Exonic
1018742956 6:166744377-166744399 CGGCCCCGGGCCCGGGGAGTCGG + Intronic
1019340176 7:505220-505242 CGGCTTGGGGCCTGGGGGCCGGG - Intronic
1019795216 7:3043751-3043773 CGGCTCCGGGCCCGGGGGGACGG - Exonic
1020136888 7:5592695-5592717 GGGCCCCGGGCCGAGGGACCCGG - Intergenic
1023381162 7:39609816-39609838 CGGCTCCGGGCCCCAGGCCCTGG + Intronic
1023638762 7:42237839-42237861 CCACTCCGGGCTTGGGGACCCGG - Intronic
1024579853 7:50793038-50793060 CGCCTCCGGGCCGGGGGCTCCGG - Intronic
1025028246 7:55535512-55535534 TGGCTGCGGGGCGGGGGACTGGG - Intronic
1025940860 7:66075633-66075655 CGGCCCCGGGGCGGGGAAGCGGG - Intergenic
1026787866 7:73313160-73313182 CGGCCACGGGCAGGGGTACCCGG + Exonic
1027774086 7:82443586-82443608 CGGCTCCGCGCCTCGGGCCCCGG - Exonic
1027995649 7:85423334-85423356 GGGCTCCGGCCCAGAGGACCTGG - Intergenic
1029238760 7:99143870-99143892 CGGCTCCGGGCTGGGCGCCGGGG + Exonic
1029456939 7:100676213-100676235 CGGCTGGGGGCCGCGGGACGGGG - Exonic
1029461047 7:100694070-100694092 GGGCTGCGGGCCGGGGGCCGCGG + Intergenic
1029694677 7:102204935-102204957 CTGCTCCCGGCCCGGGGGCCTGG + Intronic
1034159513 7:148982754-148982776 CGGCCCAGGGCTGGGGGCCCAGG + Intergenic
1034440277 7:151082622-151082644 GGGCTCCTGGCCAGGGGGCCCGG - Intronic
1034475104 7:151277084-151277106 GCGCTCCGGGCCGGGGTCCCGGG - Intronic
1034617981 7:152435701-152435723 GGGCTCGGGGCCGGGGCTCCAGG + Exonic
1035265159 7:157686010-157686032 CCGCGCGGGGCCGCGGGACCTGG + Intronic
1035464180 7:159064249-159064271 TGGCTCCGGGGCAGGGGACCGGG - Intronic
1035719663 8:1782430-1782452 CCGCTCCGGGCCGGGTGAAGTGG - Exonic
1036533070 8:9615022-9615044 CAGCTCCACGCCAGGGGACCAGG + Intronic
1036723897 8:11201609-11201631 CAGCTGCTGGGCGGGGGACCGGG + Intergenic
1037759113 8:21730112-21730134 CCGCGCCTGGCCGGGTGACCTGG - Intronic
1041910702 8:63085906-63085928 CGGCGCCGGGCCCGGGAAGCTGG - Exonic
1045994837 8:108351183-108351205 AGGCTCAGGGCCAGAGGACCAGG + Intronic
1047292325 8:123541286-123541308 GGCCTCCGGGCCGGGGGGCCGGG - Intergenic
1048344355 8:133565806-133565828 CTGCTCCGGGCCGGGGACCTTGG - Intronic
1049238940 8:141526856-141526878 CAGCTCTGGGCCTGGGGACTTGG - Intergenic
1049396471 8:142403270-142403292 CGGCTCCGCGCCGGGGCCTCTGG - Intergenic
1049409125 8:142464667-142464689 CGGCCCCGGGCCGGGCCGCCGGG + Exonic
1049659934 8:143815414-143815436 GGGCTCGGGGCCGGGGGGCGGGG + Intergenic
1049761453 8:144333730-144333752 GGGATCCGGGCCGGGGGGCCGGG - Exonic
1049973620 9:842006-842028 CGGCTCCGGGGCGTCGGACCTGG + Exonic
1051896791 9:21995844-21995866 AGGCTCCGGGTCGGGGCACCGGG - Intronic
1057390659 9:94639431-94639453 CAGGTGCGGGCCGCGGGACCTGG + Intronic
1059123260 9:111661496-111661518 CGGCTCCGCGCCGGGTGGGCTGG + Exonic
1060968483 9:127724669-127724691 CGGCTCCAGCCCGGGGGCCAGGG - Intronic
1061365982 9:130172624-130172646 CGGGTCCGGCCCGGGGGGGCGGG + Exonic
1061412837 9:130430526-130430548 CTGCTCAGGGCCATGGGACCCGG - Exonic
1061453544 9:130681749-130681771 CGGCGCCGGGCCGGGGGTTGGGG - Exonic
1061630995 9:131872115-131872137 CAGCTCCTGGCTGGTGGACCAGG + Intronic
1061807215 9:133143204-133143226 GGGCTGCGAGCCTGGGGACCTGG - Intronic
1062305841 9:135906938-135906960 CGGGCCGGGGCCGGGGGACGCGG - Intronic
1062609859 9:137368957-137368979 GGGCACAGGGCCGGGGGACGGGG + Intronic
1185894194 X:3843622-3843644 GGGCTCCGGGCCGGGTGGGCAGG - Exonic
1185899313 X:3882046-3882068 GGGCTCCGGGCCGGGTGGGCAGG - Intergenic
1185904430 X:3920475-3920497 GGGCTCCGGGCCGGGTGGGCAGG - Intergenic
1200057721 X:153470408-153470430 CCACTCCAGGGCGGGGGACCGGG - Intronic
1200121973 X:153795352-153795374 CAGCCCCGGGCCCGGGGGCCAGG + Intronic