ID: 911608237

View in Genome Browser
Species Human (GRCh38)
Location 1:99932510-99932532
Sequence GGCCAAGGCGGTGGATCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911608237_911608246 1 Left 911608237 1:99932510-99932532 CCTCAGGATCCACCGCCTTGGCC No data
Right 911608246 1:99932534-99932556 CCCAAAGTGCTGGGATTACAGGG 0: 3844
1: 4167
2: 2966
3: 3317
4: 4349
911608237_911608248 2 Left 911608237 1:99932510-99932532 CCTCAGGATCCACCGCCTTGGCC No data
Right 911608248 1:99932535-99932557 CCAAAGTGCTGGGATTACAGGGG 0: 2821
1: 3052
2: 2056
3: 1827
4: 2465
911608237_911608249 19 Left 911608237 1:99932510-99932532 CCTCAGGATCCACCGCCTTGGCC No data
Right 911608249 1:99932552-99932574 CAGGGGTGAGCCACCACTCCCGG 0: 14
1: 1283
2: 27156
3: 105089
4: 176369
911608237_911608244 0 Left 911608237 1:99932510-99932532 CCTCAGGATCCACCGCCTTGGCC No data
Right 911608244 1:99932533-99932555 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
911608237_911608242 -8 Left 911608237 1:99932510-99932532 CCTCAGGATCCACCGCCTTGGCC No data
Right 911608242 1:99932525-99932547 CCTTGGCCTCCCAAAGTGCTGGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
911608237_911608240 -9 Left 911608237 1:99932510-99932532 CCTCAGGATCCACCGCCTTGGCC No data
Right 911608240 1:99932524-99932546 GCCTTGGCCTCCCAAAGTGCTGG 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911608237 Original CRISPR GGCCAAGGCGGTGGATCCTG AGG (reversed) Intergenic
No off target data available for this crispr