ID: 911612386

View in Genome Browser
Species Human (GRCh38)
Location 1:99970931-99970953
Sequence AGATAGAATCAACAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911612386 Original CRISPR AGATAGAATCAACAGTTGGG AGG (reversed) Intronic
901869715 1:12130841-12130863 AGATAGAATCAACATTTTTAGGG + Intronic
906705544 1:47892424-47892446 ATATAGAATCTCCACTTGGGTGG - Intronic
906711162 1:47930880-47930902 AGGGAGAATCAACAGCTGTGGGG - Intronic
908551424 1:65212473-65212495 AAATAAAATAAAAAGTTGGGTGG - Intronic
909231088 1:73091431-73091453 AGAAAAAGTCAAGAGTTGGGAGG - Intergenic
909380890 1:74997158-74997180 AGACAGAAAGAACAGTTAGGAGG - Intergenic
911379218 1:97091290-97091312 AGCTAAAATAAACAGATGGGTGG + Intronic
911612386 1:99970931-99970953 AGATAGAATCAACAGTTGGGAGG - Intronic
916964169 1:169918122-169918144 AGACAGAACCAACAGGAGGGAGG - Intergenic
918213067 1:182368760-182368782 AGATAAAATAAACAGATGGGAGG - Intergenic
918455835 1:184712892-184712914 ATAGAGAATCAACAGCAGGGAGG + Intronic
918626529 1:186661907-186661929 AGATATAATTGACAGGTGGGGGG - Intergenic
919085301 1:192913864-192913886 AGCTAGAATCAACAGTTCAAGGG - Intergenic
919126407 1:193398531-193398553 AGATAAAATCAACATTTGTTTGG + Intergenic
922212343 1:223495800-223495822 GGATAGGATCAACAGTTGCATGG - Intergenic
923090361 1:230735836-230735858 TGATAGACTGAGCAGTTGGGGGG - Intergenic
1064523043 10:16223571-16223593 ACATGGAATCAACTGTTGTGGGG - Intergenic
1068055120 10:52003533-52003555 AGAAAGACACAACTGTTGGGAGG - Intronic
1069771138 10:70901300-70901322 ATATACAATCTACACTTGGGGGG + Intergenic
1070273518 10:74981733-74981755 AGATAGATTATACTGTTGGGGGG - Intronic
1073095862 10:100979345-100979367 AGATAGGATCCACTGTGGGGAGG + Intronic
1076127739 10:127988645-127988667 AGATGGAAACAACAGATGCGGGG + Intronic
1076234339 10:128852115-128852137 AGATAAAATAAACATTTCGGGGG - Intergenic
1077582351 11:3424486-3424508 AGACAGAATCAACAGTTTCTGGG + Intergenic
1079405393 11:20140880-20140902 AGGTAAAATCAACAGATGGTAGG - Intergenic
1084239262 11:67807305-67807327 AGACAGAATCAACAGTTTCTGGG + Intergenic
1084833171 11:71785541-71785563 AGACAGAATCAACAGTTTCTGGG - Intergenic
1085794640 11:79527656-79527678 AGATAGAATAAAGAGTGTGGTGG - Intergenic
1087240578 11:95772039-95772061 AGAATGAATCAAGATTTGGGAGG + Intronic
1087348186 11:96998102-96998124 AGTTAGAATCAAAAGTTCAGAGG - Intergenic
1089358557 11:117871601-117871623 TGAAAGAATAAACACTTGGGAGG + Intronic
1094208591 12:27866627-27866649 AGATGGAATCAGCAGTTAAGTGG - Intergenic
1101375200 12:104165427-104165449 AGATATAATGAACAGATGGATGG - Intergenic
1106366027 13:29081905-29081927 AGATGGAATCAACTTTTGGCCGG + Intronic
1107979393 13:45720003-45720025 AGATAGGATCAACAGTTATCTGG - Intergenic
1108243611 13:48492977-48492999 AGATAGGAGCAACATTTTGGGGG - Intronic
1110252269 13:73393884-73393906 ACATAGAAACAACAGTATGGTGG + Intergenic
1110314109 13:74085310-74085332 ATATAAAATCCACAGTTCGGAGG + Intronic
1111338954 13:86858578-86858600 AGAAAGTATCAACAATTTGGGGG + Intergenic
1111862812 13:93729563-93729585 AGATAACATCAAGAGTTGGCAGG + Intronic
1112140823 13:96639953-96639975 AGATGCAATCAACAGTGGGCTGG - Intronic
1112221721 13:97498000-97498022 AGAGAGATTCAACGTTTGGGTGG + Intergenic
1115755502 14:36523422-36523444 AGTTAGAAAAAGCAGTTGGGGGG - Intergenic
1116161229 14:41268871-41268893 AGATAGAATCATCAGTGTGCTGG - Intergenic
1117339578 14:54781838-54781860 AGACAGAAAGACCAGTTGGGTGG - Intronic
1117833795 14:59780914-59780936 AGATGGAATCAGAATTTGGGGGG - Intronic
1118408172 14:65448076-65448098 AGATAGAATCAACAGGTCAGGGG - Intronic
1123058898 14:105585643-105585665 AGAGAGAATCAACAGATGAGGGG - Intergenic
1123083223 14:105705873-105705895 AGGGAGAATCAACAGATGAGGGG - Intergenic
1126127389 15:45308252-45308274 GGATAGAATCAAGAGTTCAGGGG + Intergenic
1127177140 15:56371549-56371571 AGAGAGAATCAGCAGATGTGAGG - Intronic
1127383968 15:58452645-58452667 AGATGGAATCTGCAGTGGGGAGG + Intronic
1128405435 15:67332674-67332696 AGATACAATCAAGATTGGGGAGG + Intronic
1132134502 15:99322015-99322037 AGAAAGAGTCTACGGTTGGGAGG + Intronic
1133350931 16:5099711-5099733 AGACAGAATCAACAGTTTCTGGG + Intergenic
1134355910 16:13482139-13482161 AGATGGATTCAACCATTGGGAGG + Intergenic
1138743534 16:59337383-59337405 AGAGTGAATTAACAGTTGAGTGG - Intergenic
1139510213 16:67423733-67423755 AGTTACAATCAACAGTAGGAAGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1144535907 17:16091747-16091769 AAATATAATAATCAGTTGGGAGG + Intronic
1145271831 17:21408980-21409002 TGATTGAATCAACAGGTGGGTGG - Intronic
1145310044 17:21696444-21696466 TGATTGAATCAACATGTGGGTGG - Intronic
1152900109 17:82936220-82936242 AGAGAGAATCAGCAGCTGGCAGG - Intronic
1153500769 18:5747354-5747376 AGCTAGATTCAGCAGTTGGAGGG - Intergenic
1155577117 18:27259872-27259894 AGCTAGAGTCCCCAGTTGGGAGG + Intergenic
1155678906 18:28465686-28465708 AGAAAGAATCAACAGAAGGCTGG + Intergenic
1156411352 18:36830563-36830585 ATATAGAATCAATGGTTTGGGGG + Intronic
1158888378 18:61850076-61850098 AGGTAGAATCCACAGTTAGGTGG - Intronic
1160165654 18:76509379-76509401 AGATAGAAAAAACAGTAGTGAGG + Intergenic
1164807208 19:31126278-31126300 GGCTAGAATCAACAGTTAGGTGG - Intergenic
1166799961 19:45450792-45450814 AGAGAGAATGAACAGTCGGCCGG + Intronic
926518076 2:13874760-13874782 ATATGGACTTAACAGTTGGGTGG - Intergenic
927021692 2:19023723-19023745 AGATAGAATGATAGGTTGGGAGG + Intergenic
927241418 2:20922889-20922911 AGATAGAATCTGCAGTCAGGAGG - Intergenic
927357721 2:22192420-22192442 AGTTAGAGTCAAAAGTAGGGTGG - Intergenic
927746120 2:25622933-25622955 AGATGGAATAAACAGTAGGATGG + Intronic
928534290 2:32225164-32225186 CCATAGAAACAACAGTTAGGTGG - Intronic
930154204 2:48089072-48089094 AGATAGGATAAACAGTGAGGGGG + Intergenic
932996820 2:76864990-76865012 AGTAAGAATCAAGATTTGGGAGG - Intronic
934121576 2:88845428-88845450 AGGAAGGATCAACAGATGGGTGG + Intergenic
937230076 2:120393082-120393104 AGAAAGCAGAAACAGTTGGGTGG - Intergenic
938134249 2:128740853-128740875 AGATAGGATGAACAGTTGAATGG + Intergenic
942004207 2:171681280-171681302 AGATGGAATCAACAAATGTGGGG + Intergenic
942605619 2:177687265-177687287 AGACAGAAGCAACAGTTGGGAGG - Intronic
944352961 2:198751657-198751679 AGATAAAATCAACATTTGTGGGG - Intergenic
944614827 2:201449987-201450009 AGAAAGAACCAACATTTGGCCGG - Intronic
947861928 2:233366607-233366629 ACATAGATTCAGCAGTTAGGTGG + Intronic
1170282870 20:14670798-14670820 TGGTAGAAAGAACAGTTGGGAGG - Intronic
1170371214 20:15650304-15650326 AGATTGTATCAACAGTTCCGTGG + Intronic
1170613489 20:17932076-17932098 AAATAAAATAAACAGTTTGGGGG + Intergenic
1174713525 20:52732152-52732174 ACATAGAATTTAGAGTTGGGTGG + Intergenic
1174776238 20:53345678-53345700 AGATATAATCAACAGAATGGGGG - Intronic
1177474286 21:21598464-21598486 ACATAGAATCAAAATTTGGATGG - Intergenic
950650938 3:14406267-14406289 ACCTATAATCAACACTTGGGAGG - Intronic
951103747 3:18719355-18719377 AGATAGAATTAACAGGTTTGGGG + Intergenic
951132091 3:19059488-19059510 AGATACAAACAAAAGTTGAGAGG + Intergenic
951264444 3:20549714-20549736 AGAAAGAATGAACAGTGAGGTGG + Intergenic
952618166 3:35300843-35300865 AGAAACAACCAACAGTGGGGTGG - Intergenic
957204023 3:77171255-77171277 AGATATAATCAGCAGTTGTCAGG + Intronic
961299647 3:125914619-125914641 AGACAGAATCAACAGTTTCTGGG - Intergenic
961448196 3:126990943-126990965 ACATGGAATGAACAGGTGGGAGG - Intronic
966087786 3:176090875-176090897 AGATAGCATCTCCAGCTGGGAGG - Intergenic
966426405 3:179784570-179784592 ATAGAAAATCAGCAGTTGGGTGG + Exonic
969986210 4:11213623-11213645 AGACAAAATCAACAATTGGATGG + Intergenic
971104713 4:23511659-23511681 AGATAAAATAATCAGTTGGCTGG - Intergenic
972144521 4:36005978-36006000 AAAGAGAATCAACAATTGGAAGG - Intronic
972326166 4:38017085-38017107 AGTCAGAATCCAAAGTTGGGTGG - Intronic
973114041 4:46432410-46432432 AGATAGTATCAATTTTTGGGGGG + Intronic
975900582 4:79147018-79147040 AGACAGAATAAAAAATTGGGTGG + Intergenic
976553646 4:86425122-86425144 AGAAAGAATCAACATGTGGAGGG + Intronic
982936270 4:161480732-161480754 AGACAGAATAAGCAGCTGGGAGG + Intronic
983764927 4:171467387-171467409 ATTTAGAATCAGCAGTTGGTGGG - Intergenic
986436198 5:7733968-7733990 AGAAAGAATCAAAAGTTGAAAGG - Intronic
988564194 5:32308025-32308047 AGAAATAAGCAACAGTTGGCTGG + Intronic
992779552 5:80115417-80115439 AGATTGAATTAATAGTTGGTGGG - Intronic
1000490895 5:161912245-161912267 AGAGAGAATCGGCGGTTGGGGGG + Intergenic
1000948771 5:167454658-167454680 AAATAGAACCAACGGTTGAGTGG - Intronic
1005638514 6:27773342-27773364 AGATGGAATGGAGAGTTGGGGGG - Intergenic
1011540845 6:88426726-88426748 AGACAGAAACAAAAGTAGGGTGG + Intergenic
1012079073 6:94732934-94732956 AAATAGAATCATCAGTTAGAAGG + Intergenic
1012681958 6:102193587-102193609 AGATAGAATCAACAATTCTCCGG + Intergenic
1013750199 6:113396767-113396789 AGATACATTCAACAGTGGAGTGG + Intergenic
1024050304 7:45616979-45617001 AGATGGATTCAAAACTTGGGAGG - Intronic
1024843241 7:53612299-53612321 ATATAGAATAAACAGTTTAGGGG + Intergenic
1029020027 7:97355413-97355435 AGATAAATTCAAAAGTTTGGAGG - Intergenic
1031287372 7:119886763-119886785 ACAGAGATTCAACAGTTTGGAGG - Intergenic
1031669632 7:124527119-124527141 AGATAGAAAAACCAGTTAGGAGG - Intergenic
1032371881 7:131363888-131363910 AGATAGGATCTCCAGTTGTGAGG - Intronic
1036567905 8:9953478-9953500 AGAGAGATTCAACAGAAGGGAGG - Intergenic
1039550100 8:38437134-38437156 ATTTAGAATCAAGAATTGGGAGG - Intronic
1040317089 8:46269292-46269314 AGCAAAAATCAAAAGTTGGGTGG + Intergenic
1040620988 8:49092742-49092764 AGATAGTAGCAACAGATGTGAGG - Intergenic
1041158064 8:55008286-55008308 AGATATAATCAAAAGTTTGCTGG + Intergenic
1043501769 8:80865402-80865424 ACAGAGAAGTAACAGTTGGGTGG + Intronic
1044918570 8:97143386-97143408 ACATAGAATCAACATATGGTAGG + Exonic
1045179904 8:99769860-99769882 AAATAGAGTCAATAATTGGGTGG + Intronic
1055533239 9:77208844-77208866 AGAAAGAATCAAGAATTGGAGGG - Intronic
1056310558 9:85336873-85336895 AGCTAGAATTAACACTTGGAAGG + Intergenic
1057994652 9:99809952-99809974 AGATAGAGTGAAGAGATGGGAGG - Intergenic
1060791948 9:126491366-126491388 AGAAAGAATGAACAATTGTGCGG - Intronic
1186591382 X:10933587-10933609 AAATAGAAACAACACTTGGAAGG - Intergenic
1190067678 X:47252935-47252957 AAATAAAACCAACAGTTGGCTGG - Intergenic
1192460074 X:71309575-71309597 AGATAGAATCTACATTTGGCCGG - Intergenic
1192606396 X:72523575-72523597 AGAGAGCATCAACATTTAGGGGG - Intronic
1193462478 X:81807545-81807567 AGACACATTCAACAGTTGGTTGG + Intergenic
1193593329 X:83417515-83417537 AGATAGAATTCACAGGTGGAAGG - Intergenic
1193839178 X:86387935-86387957 GGCTAGAATCAAAAGTTTGGGGG - Intronic
1194931812 X:99897600-99897622 AGAAAGTATCAACAGCTGGCAGG - Intergenic
1195727124 X:107929716-107929738 GGATAGAGTCAAAAGTAGGGTGG - Intergenic
1198063773 X:133075133-133075155 AGTAAGAATCAACAGAGGGGAGG - Intronic