ID: 911613124

View in Genome Browser
Species Human (GRCh38)
Location 1:99978673-99978695
Sequence TTTTGTGAGCAAAAAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911613121_911613124 17 Left 911613121 1:99978633-99978655 CCTTGTTTTTTCTATGGAAATGT 0: 1
1: 0
2: 3
3: 76
4: 520
Right 911613124 1:99978673-99978695 TTTTGTGAGCAAAAAGTGGATGG 0: 1
1: 0
2: 3
3: 21
4: 260
911613119_911613124 23 Left 911613119 1:99978627-99978649 CCAAGTCCTTGTTTTTTCTATGG 0: 1
1: 0
2: 1
3: 16
4: 321
Right 911613124 1:99978673-99978695 TTTTGTGAGCAAAAAGTGGATGG 0: 1
1: 0
2: 3
3: 21
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911613124 Original CRISPR TTTTGTGAGCAAAAAGTGGA TGG Intronic
901916796 1:12506343-12506365 TTTTCTGAACATGAAGTGGATGG + Intronic
902758829 1:18567452-18567474 TTGTGTGAGGAAAGGGTGGAGGG - Intergenic
902895574 1:19477516-19477538 TTTTGTGCTCAGAAACTGGAAGG - Intronic
904634208 1:31867226-31867248 TTTTGGGAGGCCAAAGTGGAAGG + Intergenic
905712643 1:40119587-40119609 TTTTGTAAGCAAAGAGGAGAGGG - Intergenic
906336661 1:44938004-44938026 TTTTCTGAGAAGAAAGTGCAAGG + Intronic
907326716 1:53643120-53643142 TGTTGTGACCCAAAAGTGGAGGG + Intronic
907934709 1:59031947-59031969 TCTTCTGAGGAAAAAGTAGAGGG + Intergenic
907971273 1:59384011-59384033 TTTTGGGTTCACAAAGTGGAGGG + Intronic
908249742 1:62255891-62255913 TTTTGGGAGGCCAAAGTGGATGG - Intronic
909663790 1:78111612-78111634 TTTTGTTAGGAGACAGTGGAAGG + Intronic
911613124 1:99978673-99978695 TTTTGTGAGCAAAAAGTGGATGG + Intronic
912368679 1:109155897-109155919 CTTTGTGAGGCCAAAGTGGAAGG + Intronic
913226678 1:116706831-116706853 TTCTGTGGGTAAAATGTGGAAGG - Intergenic
915432913 1:155880479-155880501 TTCTGTGAGGAAAAAATGGCAGG - Exonic
915978495 1:160405960-160405982 TTATGGGAGCAGGAAGTGGAGGG + Intronic
918251767 1:182709254-182709276 TTTGGTGAGCAAAGACAGGAGGG - Intergenic
919469629 1:197962173-197962195 TTTTGAGGGTAAAAAGGGGAGGG + Intergenic
920842442 1:209566000-209566022 TTTTGGAAGTAAAAAGAGGATGG - Intergenic
920913318 1:210237344-210237366 CTTTGGGAGAAGAAAGTGGAGGG + Intronic
921112116 1:212048680-212048702 TTTAGTGAGAAACAAATGGAAGG - Intronic
922436346 1:225611218-225611240 CTTTGGGAGCCAAAGGTGGAAGG + Intronic
922914246 1:229242637-229242659 TTTTGTGAGCAAATAGGGGAGGG + Intergenic
923425726 1:233867189-233867211 TTTTGTGAACAAAAATTTGAAGG + Intergenic
924850388 1:247823244-247823266 TTTTGGGAGGCAAAGGTGGAAGG + Intergenic
1064575672 10:16743885-16743907 TTTTGGGAGGACAAGGTGGAAGG + Intronic
1065041552 10:21702834-21702856 TTTTGTGGGCAATAAGTAGTTGG + Intronic
1065363750 10:24914919-24914941 TTTTATGAGTAATAATTGGATGG - Intronic
1066114991 10:32231851-32231873 TTGTGTGGGCAAAAAGCCGAAGG - Intergenic
1066985283 10:42460475-42460497 CTTTGTGAGCAAAAATTCTATGG + Intergenic
1067424284 10:46192147-46192169 TTTTGTAGGCAAAAACTGGATGG + Intergenic
1070319955 10:75347320-75347342 TTGTGTGAGAAATAAGTCGAGGG - Intergenic
1070530675 10:77334427-77334449 TTTTGTAAGAAAACAGTGCAAGG - Intronic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1073641257 10:105254863-105254885 TTTTTTCAACAAAATGTGGATGG - Intronic
1074523479 10:114245353-114245375 TGCTGTGAGGATAAAGTGGAAGG - Intronic
1077803460 11:5565792-5565814 TTTTCTGAGTAGCAAGTGGATGG + Intronic
1078163534 11:8863070-8863092 TTTTGGGAGGCAAAAGTGGGAGG + Intronic
1078855019 11:15200262-15200284 TTTTTTGATCAAAAAATGGGAGG + Intronic
1080775087 11:35378680-35378702 TTTTGTGAGCAGTAAGTTCAAGG - Intronic
1081222351 11:40477255-40477277 ATTTTTGAGCTAAAAGTGGGTGG - Intronic
1083236364 11:61353391-61353413 TTTTATGAGCAAGGACTGGAAGG - Intronic
1083569203 11:63747941-63747963 TTTTGAGAGCAGAGAGTGGCTGG + Intronic
1087852263 11:103045646-103045668 TTTTGTGAGAACCAACTGGAAGG + Intergenic
1087897524 11:103603316-103603338 ATTTGGGAACAAAAGGTGGATGG - Intergenic
1088386949 11:109269048-109269070 TTTTCTGAACAAAATGTTGAAGG - Intergenic
1088896217 11:114080381-114080403 TTTTGTGACCTAACAGTGCAGGG + Intronic
1090575951 11:128103837-128103859 TTTCGGGAGGAAAGAGTGGATGG + Intergenic
1094457619 12:30655544-30655566 TTTAGTTAGCAGGAAGTGGAGGG - Intronic
1094783567 12:33819765-33819787 TATTGTGAGCAAAAACAGAAAGG - Intergenic
1095200823 12:39381673-39381695 TTTTGTAAGGAAAATGTGGTAGG + Intronic
1095390374 12:41698834-41698856 TTCTGGGACTAAAAAGTGGAAGG + Intergenic
1095782934 12:46079984-46080006 TTTTGGGAGCCTAAAGTGGAAGG + Intergenic
1095887781 12:47206855-47206877 ATTTGAGAGCACAGAGTGGAAGG - Intronic
1097091328 12:56507753-56507775 TTTTGGGAGGACAAAGTGGGAGG - Intergenic
1097588890 12:61548951-61548973 TTTCCTGAGAAATAAGTGGATGG + Intergenic
1097626590 12:62009673-62009695 TTCTGTGAGTAATAAATGGATGG - Intronic
1097970548 12:65628531-65628553 TTTTCAGAGCAAAACTTGGAAGG + Intergenic
1098734800 12:74086471-74086493 TGTAGTTACCAAAAAGTGGAGGG - Intergenic
1098760430 12:74418057-74418079 TTCTGTTAGGAAAATGTGGATGG + Intergenic
1098902079 12:76122812-76122834 TTTTGTAAGCAAATTGTTGATGG - Intergenic
1100946057 12:99785044-99785066 TTCTGAGGGCAAGAAGTGGAGGG + Intronic
1101282905 12:103278088-103278110 TATTGAGAACAAAAAGTGGATGG + Intronic
1102941343 12:116945360-116945382 TTAGGTGAGCAAGACGTGGAAGG + Exonic
1104023110 12:125006844-125006866 TTTTGTGAGAAAAGAGTAGCAGG - Intronic
1105235963 13:18553947-18553969 TTCTGTTAGCACAGAGTGGAAGG + Intergenic
1106868346 13:33991860-33991882 TTATGAAAGCAAAAAGTAGATGG + Intergenic
1107654584 13:42578574-42578596 TTTTGGGAAAAAACAGTGGATGG + Intronic
1108483509 13:50900762-50900784 GTCTGTGAGAAAAAAGAGGAGGG - Intergenic
1108813388 13:54259345-54259367 TTGTGGGAGCAGATAGTGGAAGG - Intergenic
1109153663 13:58876727-58876749 TTTTGTGGGCAAAAATAGAAGGG - Intergenic
1111957864 13:94777736-94777758 TTTTGTGATCAAATAATGTATGG - Intergenic
1112519511 13:100083183-100083205 TTTTCTGGGAGAAAAGTGGAAGG - Intergenic
1113384512 13:109836339-109836361 TTTTGTCATTAGAAAGTGGATGG - Intergenic
1116652720 14:47614331-47614353 TTTTGGGAGCCAAAGGTGGGTGG - Intronic
1116712140 14:48382604-48382626 TTTTGTGAGCCCGAAGTGGGCGG + Intergenic
1117889492 14:60403283-60403305 CTTTGTGATCTATAAGTGGAAGG - Intronic
1118211823 14:63772498-63772520 TTTTGGGAGGCAAAGGTGGATGG + Intergenic
1118289417 14:64505466-64505488 TTTGTTCAGTAAAAAGTGGAAGG + Intronic
1118339445 14:64881635-64881657 TTTTGTTAGAAAAAAATGGAGGG + Intergenic
1120300172 14:82695806-82695828 TCCTGTGAGTAAAATGTGGATGG + Intergenic
1120316922 14:82906084-82906106 TTCATTGAGCCAAAAGTGGATGG - Intergenic
1120534437 14:85676608-85676630 GTCTGTGTCCAAAAAGTGGAAGG + Intergenic
1122289183 14:100670616-100670638 TTTTGTTTGCAGAAAGTGAAAGG - Intergenic
1123741953 15:23289001-23289023 TTTTGGGAGGCCAAAGTGGATGG + Intergenic
1123745043 15:23313557-23313579 TTTTGGGAGGCCAAAGTGGATGG - Intergenic
1124277312 15:28336878-28336900 TTTTGGGAGGCCAAAGTGGATGG - Intergenic
1124305390 15:28574728-28574750 TTTTGGGAGGCCAAAGTGGATGG + Intergenic
1125594959 15:40878938-40878960 TTTTGTCAGCAAGAGGGGGAGGG + Intergenic
1126000749 15:44207292-44207314 CTTTGGGAGGAAAAAGTGGGAGG + Intergenic
1126705513 15:51401801-51401823 TTTTGTGAGCAATTAGGGGTAGG + Intronic
1126766827 15:52018663-52018685 TTCTGTGAGCAAAGACTGGGAGG - Intronic
1127476030 15:59334049-59334071 TTTTGGGAGACCAAAGTGGAAGG + Intronic
1127960276 15:63885363-63885385 TTTCTTGAGTAAAAAGTGAAGGG - Intergenic
1131744564 15:95432845-95432867 TTTTCTGAAGAAAAAGTTGAAGG + Intergenic
1132822303 16:1880601-1880623 TTTTTTAAGAAAAAAGTGGCTGG - Intronic
1133703216 16:8328787-8328809 TTGTGTGTGCAATAAGTGAAAGG - Intergenic
1133786088 16:8974512-8974534 TCTTTTCAGCAACAAGTGGAAGG - Intergenic
1134435787 16:14255479-14255501 TTTAGGGAGGAAGAAGTGGAAGG + Intronic
1137653657 16:50141652-50141674 TATTTTGTGCAAAAAGGGGAAGG + Intergenic
1138024089 16:53509268-53509290 TATTGGGAGGAAAAAGTGGGAGG - Intergenic
1139465655 16:67152720-67152742 CTTTGTGACCAAAAAGAGTAAGG - Intergenic
1142792411 17:2277799-2277821 TTTTGTGAGGCAAAGGTGGGAGG + Intronic
1146542103 17:33705139-33705161 ATTTGTGAGAAAAAAGAGGCAGG - Intronic
1149056365 17:52371306-52371328 TTTTGGGAGTAACAACTGGAAGG - Intergenic
1151850589 17:76687511-76687533 TTTTTAGAGAAATAAGTGGATGG + Intronic
1153348623 18:4055001-4055023 CTTTGGGAGCAGAAAGTTGATGG + Intronic
1155648210 18:28107740-28107762 TTTGGGGACAAAAAAGTGGAAGG + Intronic
1156563739 18:38159739-38159761 TTTTGTGTGCTAGATGTGGATGG - Intergenic
1158432143 18:57398903-57398925 TGTTGTGAAGAAAAAGTGAAGGG - Intergenic
1158839726 18:61372072-61372094 TTGTGTGAGTGAAAAGTAGAAGG - Intronic
1163348789 19:16762206-16762228 TTTCGAGTGCAAAAAGGGGAAGG - Intronic
1166916417 19:46198664-46198686 TTTGGTGACCAAAGACTGGATGG - Intergenic
925274666 2:2640292-2640314 TTTTGAGAGCAAAATGTGCGGGG + Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
928143177 2:28748704-28748726 TTTAGGTAGCAAAATGTGGAGGG - Intergenic
928891289 2:36205943-36205965 TTCTGTGAGAAAAACCTGGATGG + Intergenic
929150743 2:38746309-38746331 TTTTGTTAGCAACAACTGGTAGG - Intronic
929306407 2:40367864-40367886 TTTTGTGAACAAGATGTGGGGGG - Intronic
929498727 2:42470913-42470935 CTTTGGGAGGCAAAAGTGGAAGG + Intronic
930170416 2:48246132-48246154 ATTTGTTAGCAAAATGTTGAAGG + Intergenic
931060740 2:58526494-58526516 TCTTGTGAGCAAATACTGGCCGG - Intergenic
931618745 2:64189050-64189072 TTTGCTGAGCACAAAGTGAAAGG - Intergenic
932551194 2:72771729-72771751 TTTTGTGAGGCCAAGGTGGAAGG + Intronic
932641285 2:73449804-73449826 CTTTGTGAGTAGAAAGTAGACGG - Exonic
935837747 2:107074015-107074037 TATGGTGAGCACAAACTGGAGGG - Intergenic
939141934 2:138364283-138364305 TATTCTTAGCAAAAAGGGGAGGG - Intergenic
939882761 2:147649125-147649147 TTTTGTGAGGAGAAAGGGGCAGG - Intergenic
942707604 2:178794229-178794251 CTTTCTGAGCAAAAGGTGGTCGG - Intronic
943406002 2:187486359-187486381 TTATGTTTGCCAAAAGTGGATGG + Intronic
945554236 2:211259486-211259508 TTATGTAAGGAAAAAATGGAGGG + Intergenic
946287099 2:218711993-218712015 CTTTCTGAGCACAAAGTGGGTGG - Intronic
1169275731 20:4232619-4232641 CTTTGTGAGCAAAGACTTGAAGG - Intronic
1169448740 20:5693470-5693492 TTTTGTGTGCAAAAAAAGGCTGG - Intergenic
1169694462 20:8371154-8371176 TTTTGAAAGCAAAAAGTGTGTGG - Intronic
1170380700 20:15756661-15756683 TTTTGTGTGCAAAAAGGAGCAGG - Intronic
1173656084 20:44701188-44701210 TTTTGGGAGCAACAGGTGGTGGG - Intergenic
1174803984 20:53591152-53591174 TTTTTTGAGTAAGAAGTGAAAGG + Intronic
1176779962 21:13182234-13182256 TTCTGTTAGCACAGAGTGGAAGG + Intergenic
1177033407 21:16011538-16011560 TTATGTGAGCAAAAGGGGGCTGG + Intergenic
1177235902 21:18389765-18389787 TTTAGTGACCAAAAAGAGGTAGG - Intronic
1178192302 21:30298509-30298531 TTTTGTGAGCAAGAAACTGAAGG + Intergenic
1179039030 21:37785245-37785267 TTTTGTGCCCAAGAAGTGGGAGG + Intronic
1179296428 21:40066853-40066875 TTTTGTGAGCAATCAGGGAAGGG - Intronic
1180879121 22:19191494-19191516 TCATTTGAGCAAAAACTGGAAGG - Intronic
1183534965 22:38395507-38395529 TTTTTTGAGTAAGAAGTGAAAGG + Intronic
1183897057 22:40977874-40977896 TTTTGTGATGAATACGTGGATGG - Intergenic
949659493 3:6261597-6261619 AGTTTTGAGCAAAAACTGGAAGG - Intergenic
950178264 3:10892107-10892129 TTTTGTGAGCAGCAAGATGACGG + Intronic
950740089 3:15043929-15043951 CCTTGTGACCAAAAAGTGCAAGG + Exonic
952041001 3:29261756-29261778 ATTTGGGAGAAAAAAATGGATGG + Intergenic
953482607 3:43264537-43264559 TTTTGGGAGAAAAAAATGGATGG + Intergenic
956778260 3:72584486-72584508 TTTGGTGAACAAACAGTGAAAGG - Intergenic
957390671 3:79563193-79563215 TTTTGTGTGCTACAAGTTGAAGG - Intronic
957540816 3:81566661-81566683 ATTTGAGAGCAAAAGGAGGAAGG - Intronic
959963544 3:112328828-112328850 TTTTGTGGATAAAAAGTAGATGG + Intergenic
960106331 3:113801641-113801663 TACTGTGAGCAAAAGATGGAAGG + Intronic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
961910724 3:130313653-130313675 TTTTGGGAGGCAAAGGTGGAAGG - Intergenic
962519883 3:136188504-136188526 TTTTGGGAGGCCAAAGTGGAAGG + Intronic
963843815 3:150134481-150134503 GTTTGGGAGACAAAAGTGGAAGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966612912 3:181886041-181886063 TTTTGTGAGGCCAAAGTGGGAGG + Intergenic
967097207 3:186186895-186186917 TCTGGTGAGTTAAAAGTGGAAGG + Intronic
967162401 3:186750561-186750583 TTTTGGGAGGACAAGGTGGAAGG + Intergenic
971443758 4:26719244-26719266 TCTTGTGAGCAAGAAGAGAATGG - Intronic
971582397 4:28358576-28358598 TGTTGTCAGCAAGGAGTGGAGGG + Intergenic
972250817 4:37298742-37298764 TTTTGTGAGGAAATAGTTTAAGG - Intronic
972461268 4:39305361-39305383 TTTTGGGAGTCCAAAGTGGATGG + Intronic
974303440 4:60099284-60099306 TTTTGTGAGCATAAAGAGAAAGG + Intergenic
974440360 4:61908058-61908080 TTTTGGGAGGCCAAAGTGGAAGG + Intronic
975663995 4:76716032-76716054 TTTTGTGGGCAAGAGGAGGAGGG - Intronic
976093813 4:81486671-81486693 TGTTGAGAGCAAACAGTGGAAGG + Intronic
976679999 4:87745824-87745846 TTTTGTGCCCAAAGAATGGAGGG + Intergenic
977650768 4:99466651-99466673 TTTTCTGGGCATAAAGAGGACGG - Intergenic
977846305 4:101772105-101772127 TGTTGTGAGAAAAAACTGGTGGG + Intronic
978475976 4:109130537-109130559 TTTTATCAGTAAAAAGGGGAAGG + Intronic
979286436 4:118930669-118930691 CTTTGGGAGCCCAAAGTGGAAGG + Intronic
981986189 4:150860326-150860348 CTTTGACAGCAAAAAGTGGTAGG + Intronic
982630100 4:157820806-157820828 TTTTGTGAAAAAAAAGTCAATGG - Intergenic
984019988 4:174474104-174474126 TTTTGAAAGCAAAATTTGGAAGG - Intergenic
984440937 4:179769368-179769390 TTTTTAGAGCAAACAGAGGAAGG - Intergenic
984527821 4:180877855-180877877 GTTTGTGAGAAAATAGTTGAGGG - Intergenic
986631112 5:9775168-9775190 CTTTGTGTGCAGAAAGGGGAGGG - Intergenic
987029211 5:13960460-13960482 TTTTGTAAGCAAAATGTGATTGG + Intergenic
991169788 5:63609136-63609158 TTTTATAAGCAAAAATTAGAAGG - Intergenic
994120941 5:96111888-96111910 TTTTGGGAGGCCAAAGTGGAAGG - Intergenic
995511890 5:112918772-112918794 CTGTGTGAGCAAAGAGTGGTGGG - Intronic
996039535 5:118794605-118794627 CTTAGGGAGCAGAAAGTGGAGGG + Intergenic
996204925 5:120721609-120721631 TGTTGTGAGCAAGTAGTGGAAGG + Intergenic
997475932 5:134142472-134142494 TTTTCTGAGCCAACAGAGGAGGG + Intronic
998928820 5:147157714-147157736 TTTGGTGAGCTAAAGATGGAGGG - Intergenic
999053185 5:148545902-148545924 TCTTGTGAGCGACAAGTGGATGG + Intronic
999087263 5:148903926-148903948 TTTTGTGAGCCAAAGGTGGATGG - Intergenic
999619786 5:153460995-153461017 TTTTGAGAGGAAAGATTGGAGGG + Intergenic
1000645301 5:163754400-163754422 TTTTGTTAGAAAGAAGTGGCTGG - Intergenic
1003876184 6:10439424-10439446 TATTGGGAGAATAAAGTGGAGGG + Intergenic
1004223016 6:13762714-13762736 TCTTTTGAGCATAAAATGGAGGG + Intergenic
1005264497 6:24097423-24097445 TTTTGTGGGAAAAAAATGGATGG - Intergenic
1010764187 6:79760081-79760103 TTTTTTGAGTAAAAACTGCAAGG + Intergenic
1012246805 6:96935478-96935500 TTTTGTGAAGGAAAAGAGGAGGG + Intronic
1014573389 6:123039719-123039741 TTTTGTGAGCAAAACATACATGG - Intronic
1015802778 6:137077518-137077540 CTTTGTGAGGAAAAGGTGGGAGG + Intergenic
1015936279 6:138408322-138408344 TTTTCTAAGCAAAATGTGAATGG - Intronic
1016989450 6:149919276-149919298 TCTTGTGAGCAGAAAGCCGAAGG - Exonic
1016993686 6:149946398-149946420 TCTTGTGAGCAGAAAGCTGAAGG + Exonic
1017004648 6:150021138-150021160 TCTTGTGAGCAGAAAGCTGAAGG - Exonic
1017070850 6:150574609-150574631 TTTTGTGAACAAAAAGAGGAAGG + Intergenic
1018608644 6:165625028-165625050 TTTGGTGAGCTCAAAGTGCATGG + Intronic
1019117368 6:169775966-169775988 TTTTGTAATCAAAGAGTGGCAGG - Exonic
1020731032 7:11880464-11880486 TGTTATGAGAAAAAAGTGAATGG + Intergenic
1021737319 7:23652894-23652916 TTCTGTGACCAAAATGTGGGAGG + Intergenic
1021906738 7:25341735-25341757 TTTTGTGGTCAAACAATGGAAGG + Intergenic
1023333943 7:39148909-39148931 TTTTGTCAGTAAAGTGTGGAAGG + Intronic
1023651365 7:42372715-42372737 CTGTCTGAGCAAAGAGTGGAGGG + Intergenic
1024669483 7:51579723-51579745 TTTTGTTAGCTTAAGGTGGATGG + Intergenic
1025812943 7:64887031-64887053 CTTTGTGAGGAATAAGTGAAGGG - Intronic
1026476653 7:70741985-70742007 TTTTGTCTGCAAAAAGTACAAGG - Intronic
1027266480 7:76497739-76497761 TTTTGTAAGCAACAAGTTGTGGG + Intronic
1027606202 7:80302021-80302043 TTTTGTCAACAAAAAGAGCAGGG + Intergenic
1027647841 7:80826593-80826615 TTTATTGAGCAAATAATGGAAGG + Intronic
1029280338 7:99431369-99431391 TTTTGGGAGCCCAAAGTGGGCGG - Intronic
1029906726 7:104100409-104100431 AATGGTGAGCAAAAACTGGAGGG - Intergenic
1029950228 7:104576328-104576350 TTTTGTAAGCCAAATGTGGGAGG + Intronic
1033416909 7:141169909-141169931 TCATGTGAACAAACAGTGGAAGG - Intronic
1033657730 7:143384348-143384370 TTTGGAGAACAGAAAGTGGAAGG + Intronic
1033770892 7:144550136-144550158 TTTTGGGGGCAGAGAGTGGAGGG + Intronic
1035000486 7:155608879-155608901 TGTTGTGAGGGAAAGGTGGAGGG + Intergenic
1035092973 7:156329746-156329768 TTTTCTGAGCAGAGGGTGGAAGG - Intergenic
1038100451 8:24368124-24368146 TTTTGTTAGTATAAAGTGGTTGG - Intergenic
1039768328 8:40655327-40655349 TTTTGTGTTCATAAATTGGAAGG + Intronic
1040032472 8:42838441-42838463 TTTTGTGAGGAAGAGGTGGGCGG + Intronic
1040347825 8:46526368-46526390 TTTTGTGATTAAAAAGTAGAAGG + Intergenic
1040602064 8:48895498-48895520 TTCTGTGAATAAAAACTGGATGG + Intergenic
1041283589 8:56236903-56236925 TTTTGTGAGAAAATACTGCAAGG + Intergenic
1041606482 8:59787918-59787940 TTTGGTGAGCAAAATGTCTAGGG + Intergenic
1041935859 8:63331172-63331194 TTTTGTGAGCTAGAACTAGACGG - Intergenic
1043451230 8:80368976-80368998 TTATGAGAGTAAGAAGTGGAAGG + Intergenic
1044034542 8:87284099-87284121 TTTACTCAGGAAAAAGTGGAGGG - Intronic
1044289162 8:90447290-90447312 TTTTGGGAGAACAAGGTGGAAGG - Intergenic
1045449627 8:102309296-102309318 TTTTGGGAGGCCAAAGTGGATGG - Intronic
1045949997 8:107840730-107840752 TTGTGTGGGCACATAGTGGAGGG - Intergenic
1046046169 8:108967394-108967416 TTTTTAAAGCACAAAGTGGAAGG + Intergenic
1046548688 8:115684478-115684500 TTTGGTGAGCTAAAAGTGAACGG - Intronic
1046934359 8:119872415-119872437 TTTTGTGAGGATAAAGTGTTTGG + Intergenic
1047046388 8:121057304-121057326 CTTAGAGAGGAAAAAGTGGAGGG + Intergenic
1048169008 8:132087330-132087352 TAATATGAGAAAAAAGTGGAAGG + Intronic
1048983123 8:139713922-139713944 TTTTGTGATCAAAAATAGAAAGG - Intergenic
1050588911 9:7142355-7142377 TTTTGGGAGGCCAAAGTGGAAGG - Intergenic
1050744849 9:8863387-8863409 TCTTGTGAGCAAGAAGTGAAGGG + Intronic
1051541691 9:18227105-18227127 TTTTGTTAGGAAAAAATGGAGGG - Intergenic
1051866271 9:21686478-21686500 TTTTCTGAGCAAAGAGTAGAAGG + Intergenic
1053044536 9:34904115-34904137 TATTGTCAGCAAACAGTGAAGGG + Intergenic
1055778962 9:79798479-79798501 TTTTTAAAGCAAAAAGTGAATGG + Intergenic
1057374924 9:94512374-94512396 TTCTGTGATTAAAAAGTTGAAGG + Intergenic
1058160884 9:101569468-101569490 TCTTGTGAGCATGAAGTGAACGG - Exonic
1058546331 9:106063909-106063931 ATTTCTGAGCAAAATGTCGAAGG + Intergenic
1060123122 9:121014872-121014894 TTTTGTCAGAATAAAATGGAAGG + Intronic
1060603323 9:124892687-124892709 CTTTGGGAGGCAAAAGTGGACGG + Intronic
1061364679 9:130165757-130165779 TTTTGGGAGGACAAGGTGGAGGG + Intergenic
1185883430 X:3760302-3760324 ATTTTTGAGGAAAGAGTGGAGGG - Intergenic
1186100062 X:6146362-6146384 TTTTTTGAGGAAAAACTTGATGG - Intronic
1186258880 X:7754448-7754470 TTCTGGGAGCATAAAGAGGATGG + Intergenic
1186599105 X:11017395-11017417 TTTTTTGAGCAAAAAATAAATGG + Intergenic
1187344798 X:18453152-18453174 TTGTGTGACCAAAAAGAAGAGGG - Intronic
1187384440 X:18834623-18834645 TTTGGTGAGGAAAAAATAGAAGG + Intergenic
1188039496 X:25355495-25355517 TTTTCTGGCCAAAAAGTGAAGGG - Intergenic
1188612804 X:32120151-32120173 ATTTGTGAGCATAAAGTCGAAGG - Intronic
1188612845 X:32120593-32120615 ATTCGTGAGCATAAAGTTGAAGG + Intronic
1188778938 X:34256062-34256084 TTTTGAGATCATAAAGTAGAAGG - Intergenic
1190620935 X:52286129-52286151 TTTTGTAAGTAAAAAGTGAATGG + Intergenic
1191633698 X:63353022-63353044 TCTTCTGAGCAAAAAGTGCTTGG - Intergenic
1192028359 X:67480990-67481012 TTTTGTGAAAAAAAATTGGTGGG + Intergenic
1193743154 X:85243368-85243390 TTCTGTCTGCAAAAAGTGGGAGG - Intergenic
1194552320 X:95317263-95317285 TCTTGTAGGCAACAAGTGGATGG + Intergenic
1195313686 X:103657615-103657637 TGCTGTGGGAAAAAAGTGGAGGG - Intergenic
1195583863 X:106539893-106539915 TTTTCTTAGGAAAAAGTGGTAGG - Intergenic
1196038977 X:111180561-111180583 TTTTATGAGGAAAAATTGGGAGG + Intronic
1197265175 X:124361766-124361788 ATTTCTGAGCAAAAAGTTGAAGG + Intronic
1199179545 X:144837245-144837267 ATTTGTGAAAAAAAAGTGGAAGG + Intergenic
1199314711 X:146363359-146363381 TTTTGATTGCAAAAAGTAGAGGG - Intergenic
1199530196 X:148838111-148838133 GCTTGTGAGCAAGAACTGGAAGG - Intronic
1199560838 X:149160993-149161015 TTTTGTGAGCACACAGTAGTGGG + Intergenic
1199854777 X:151751456-151751478 TTGTGTGAGCAAAACCTGCAGGG - Intergenic
1200892261 Y:8336481-8336503 TTTAGTAACCACAAAGTGGATGG + Intergenic