ID: 911613154

View in Genome Browser
Species Human (GRCh38)
Location 1:99979244-99979266
Sequence CAGAGCAACCAGATGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911613154_911613160 16 Left 911613154 1:99979244-99979266 CCTCACTCCATCTGGTTGCTCTG 0: 1
1: 0
2: 0
3: 20
4: 311
Right 911613160 1:99979283-99979305 TTTCCTCTTCCAGCTTCTGTTGG 0: 2
1: 19
2: 177
3: 666
4: 1683

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911613154 Original CRISPR CAGAGCAACCAGATGGAGTG AGG (reversed) Intronic
900607518 1:3530491-3530513 CAAAGCAACCACCTGGAGGGAGG + Intronic
900710481 1:4110096-4110118 CAGTGCGACCAAGTGGAGTGGGG + Intergenic
900779863 1:4611221-4611243 AAGCGCAATCAGGTGGAGTGGGG - Intergenic
901744887 1:11365836-11365858 TAGAAGAAGCAGATGGAGTGAGG - Intergenic
902770069 1:18640789-18640811 CAGTGCGACCAGAGGGAGAGAGG + Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
905520713 1:38597392-38597414 CTCATCAGCCAGATGGAGTGAGG - Intergenic
905634796 1:39543104-39543126 CAGAGGAACCAGCTGAGGTGAGG + Intergenic
906345617 1:45012648-45012670 CGAAGCAACCAGAGGGACTGGGG - Intronic
906919480 1:50048382-50048404 CAGAGCCGCCAGATGGGCTGCGG - Intronic
907750400 1:57257728-57257750 CAGAGCCCCCAGAGGGAGTATGG - Intronic
908427345 1:64020094-64020116 CAGGGCCACCAGAAAGAGTGTGG + Intronic
911335784 1:96578497-96578519 CAGTGCCACCAGATGGAATTTGG - Intergenic
911613154 1:99979244-99979266 CAGAGCAACCAGATGGAGTGAGG - Intronic
911849450 1:102798228-102798250 CAACCCAATCAGATGGAGTGAGG + Intergenic
914974621 1:152349868-152349890 CAGTGCAACCATATGCAGTGGGG - Exonic
915782202 1:158564634-158564656 AAGAGCCTCCAGAGGGAGTGCGG + Intergenic
915819394 1:159005873-159005895 GAGAGCAACCAGATGGCCTAAGG + Intronic
916001027 1:160615917-160615939 TAAAGCCTCCAGATGGAGTGTGG + Intronic
916786113 1:168088254-168088276 CAGAGCAGGCAGAGGGAATGGGG + Intronic
917790898 1:178498034-178498056 CACAGCAACCACATGACGTGAGG + Intergenic
918083396 1:181224532-181224554 TAGAGCCTCCAGAGGGAGTGTGG + Intergenic
920043213 1:203117231-203117253 TAGAGCAGCCAGATGAAGTGGGG + Intronic
920766347 1:208837262-208837284 TTGAGCTACCAAATGGAGTGGGG - Intergenic
921685445 1:218083943-218083965 CAGAGCTTTCAGAGGGAGTGTGG - Intergenic
921818688 1:219592423-219592445 GAGAGGAACCAGATGAAATGCGG - Intergenic
923142754 1:231175141-231175163 CCCAGCAACCTGATGGTGTGTGG - Intronic
923397386 1:233580526-233580548 CACAGCCACCAAATGCAGTGGGG - Intergenic
924601913 1:245498471-245498493 CACAGCAACCAGCAGAAGTGAGG + Intronic
1066581691 10:36888886-36888908 CAGAGCAACCACACTCAGTGGGG - Intergenic
1067041807 10:42958057-42958079 CAGAGCACCCAGGGGGACTGTGG + Intergenic
1067530013 10:47063607-47063629 CAGAGAAAGTATATGGAGTGGGG - Intergenic
1068715341 10:60181395-60181417 TTGAGCAGCCAAATGGAGTGGGG + Exonic
1069984779 10:72275572-72275594 CAGAGCAGCCGGAGGGAGGGGGG + Exonic
1070786538 10:79165413-79165435 CAGAGCTTCCAGAGGGAGGGAGG + Intronic
1075117053 10:119635781-119635803 AAGAGCAAACATATGGAGTTAGG - Intergenic
1075960390 10:126563124-126563146 AACAACAACCAGCTGGAGTGCGG - Intronic
1077113414 11:872022-872044 CAGAGCTACCCGATGGGGTCTGG - Intronic
1077417191 11:2429940-2429962 CAGGGCAGCAGGATGGAGTGAGG - Intergenic
1078118570 11:8481616-8481638 GAAAGCTACAAGATGGAGTGAGG - Intronic
1078734413 11:14006985-14007007 TAGAGCCCCCAGAGGGAGTGTGG - Intronic
1079571143 11:21944783-21944805 CAGAACAAGCAGCTGGACTGAGG + Intergenic
1088198613 11:107304810-107304832 TAGACCCTCCAGATGGAGTGTGG + Intergenic
1088907799 11:114167985-114168007 AAGAGCGATCAGATGGAGGGCGG - Intronic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1091209426 11:133843765-133843787 CAGAGCCACGAGAGGCAGTGGGG + Intronic
1091566321 12:1651144-1651166 CAGAGCACCAATATGGAATGAGG - Intergenic
1092410451 12:8248924-8248946 CTGACCAACCAGATGGTTTGAGG - Intergenic
1092526245 12:9311951-9311973 CAGACCAGCCAGCTGGAGGGAGG + Intergenic
1092541031 12:9419839-9419861 CAGACCAGCCAGCTGGAGGGAGG - Intergenic
1092549134 12:9478647-9478669 CAGAGGAGCGAGGTGGAGTGGGG + Intergenic
1093081806 12:14821360-14821382 CAGAGCCCCCAGAGGGAGAGAGG - Intronic
1094503862 12:31043820-31043842 CAGAGGAGCGAGGTGGAGTGGGG - Intergenic
1094512014 12:31102647-31102669 CAGACCAGCCAGCTGGAGGGAGG + Intronic
1094742934 12:33310399-33310421 CAGAGCTACAGGCTGGAGTGGGG + Intergenic
1095511795 12:42959067-42959089 CATAGCAACCAAATGTACTGTGG - Intergenic
1095698230 12:45164745-45164767 CAGAGCACCCAGTGGGAGGGGGG - Intergenic
1096815934 12:54201726-54201748 CAGGGTCACCAGATGGAGAGCGG - Intergenic
1099970329 12:89493745-89493767 CAGAACAGCCTGCTGGAGTGTGG - Intronic
1101752467 12:107593761-107593783 CAGAGCAACAAGAGGGAAGGTGG - Intronic
1101835092 12:108289429-108289451 CAGAGCAGCCAGAAAGAGGGAGG + Exonic
1102868591 12:116394245-116394267 CAGAGCCTCCAGAGGCAGTGTGG - Intergenic
1104749349 12:131228418-131228440 CAGAGCAGCTAGATACAGTGTGG - Intergenic
1105395824 13:20033413-20033435 CAAAGAAGCCACATGGAGTGAGG - Intronic
1106969842 13:35126207-35126229 CAGGGCAGGAAGATGGAGTGAGG - Intronic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1109547547 13:63847717-63847739 CGGAGCATCCACATGAAGTGTGG - Intergenic
1113070291 13:106413909-106413931 AAGAGACAGCAGATGGAGTGGGG - Intergenic
1113627028 13:111855018-111855040 GAGGGCACCCAGATGGAGAGGGG + Intergenic
1114541240 14:23461093-23461115 TAGAGCCTCCAGAGGGAGTGTGG + Intergenic
1114727330 14:24953061-24953083 TAGTGCCTCCAGATGGAGTGTGG - Intronic
1115493634 14:33982225-33982247 CAGAGCATCCACACTGAGTGGGG - Intronic
1116279159 14:42879886-42879908 CAGAGCAACCAGAAAAAGTCAGG - Intergenic
1121476615 14:94213753-94213775 CAGAGCCTCTAGATGGAATGTGG + Intronic
1122971583 14:105154437-105154459 CAGGGCAACCAGAGGGGCTGGGG - Intronic
1127864448 15:63020449-63020471 CAGAACAACCATATGAAGGGGGG + Intergenic
1128133451 15:65245926-65245948 CAGAGCAGCCAGATATGGTGAGG + Intronic
1129280296 15:74480098-74480120 CAGAGCAGTTAGATAGAGTGTGG + Intergenic
1129775781 15:78235412-78235434 CACAGCCCCCAGAGGGAGTGTGG - Intronic
1131379253 15:91950170-91950192 CAGAGGAAGCAGCTGGAATGAGG + Intronic
1131516417 15:93080583-93080605 CAGAGCAAGAGGATGGAGTAGGG - Intronic
1131629200 15:94157986-94158008 TAGAGCTCCCAGATGGTGTGGGG - Intergenic
1132028238 15:98420728-98420750 CATAGGGACCAGATGGAGAGGGG - Intergenic
1132118957 15:99159958-99159980 CTGAGGAACTAGATGGAGTGGGG + Intronic
1132680905 16:1141350-1141372 CCGAGCAGCCCGATGGAGGGGGG + Intergenic
1133330035 16:4967185-4967207 TAGAGCCTCCAGAGGGAGTGTGG - Intronic
1136271912 16:29153567-29153589 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271923 16:29153601-29153623 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271934 16:29153635-29153657 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271944 16:29153669-29153691 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271977 16:29153771-29153793 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136710927 16:32235608-32235630 CTGACCAACCAGATGCAGTAAGG + Intergenic
1136756981 16:32693803-32693825 CTGACCAACCAGATGCAGTAAGG - Intergenic
1136811128 16:33176572-33176594 CTGACCAACCAGATGCAGTAAGG + Intergenic
1136817604 16:33286652-33286674 CTGACCAACCAGATGCAGTAAGG + Intronic
1136824168 16:33343181-33343203 CTGACCAACCAGATGCAGTAAGG + Intergenic
1138567882 16:57846616-57846638 GTTAACAACCAGATGGAGTGGGG - Intronic
1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG + Intronic
1139495315 16:67312680-67312702 CTGAGCAACCAGATGAATGGTGG - Intronic
1139514709 16:67446276-67446298 CAGAGCAAGCAGGGGGAGTGGGG - Intronic
1141932136 16:87212835-87212857 CAGGGCAGCCAAATGAAGTGAGG + Intronic
1142075552 16:88115655-88115677 CAGAGCCTCCAGAGGGAGTACGG - Intronic
1142075574 16:88115723-88115745 CAGAGCCCCCAGAAGGAGTACGG - Intronic
1203059130 16_KI270728v1_random:954154-954176 CTGACCAACCAGATGCAGTAAGG - Intergenic
1142821897 17:2475750-2475772 TAGAGCAAACTGATGGAGTCTGG + Intronic
1143466600 17:7141047-7141069 CACTGCAACCAGATGTAGTTGGG - Intergenic
1143484617 17:7246866-7246888 CAGAGGAACAAGATGGGCTGGGG + Intronic
1143882900 17:10043348-10043370 CAGAGAAACCAAATGAAGAGGGG + Intronic
1148640379 17:49183333-49183355 CAGGGCAACCAGCTGCAGAGAGG - Intergenic
1148746130 17:49919577-49919599 CAGAGGAAGCAGGTGGAGCGTGG - Intergenic
1149115221 17:53085956-53085978 CTGAGCAAGCACATGGAATGTGG + Intergenic
1149419611 17:56496473-56496495 TAGAGCCTCCAGAGGGAGTGTGG - Intronic
1150525148 17:65915218-65915240 CTGAGCAACCAGGTGGATGGTGG - Intronic
1150830569 17:68514878-68514900 CAGAGCAAACCACTGGAGTGAGG - Intronic
1150977581 17:70105991-70106013 CTGAGAATTCAGATGGAGTGCGG + Intronic
1151527064 17:74677737-74677759 CAGAGCAGGCAGCTGGTGTGGGG + Intronic
1151988599 17:77559584-77559606 CCCAGCGAGCAGATGGAGTGAGG - Intergenic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1152999236 18:438522-438544 CACAGCACCCAGCTGGAATGAGG - Intronic
1156381057 18:36561727-36561749 CAAAGAAAAAAGATGGAGTGGGG - Intronic
1156611449 18:38729792-38729814 AAGAGAAACCAAATAGAGTGGGG - Intergenic
1157164136 18:45342585-45342607 CAGAGCAACCAGATGAATGCAGG + Intronic
1157779522 18:50425125-50425147 GAGTACAACCACATGGAGTGGGG - Intergenic
1157779813 18:50428237-50428259 CAGAGCAAGCAAAGGGAGGGAGG + Intergenic
1158460638 18:57643413-57643435 CAGAGTAGCCAGATAGAGTGTGG + Intergenic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1158941789 18:62411565-62411587 CTGAGCCTCCAGAAGGAGTGTGG - Intergenic
1159607022 18:70485425-70485447 CAGAGCACTGAGAGGGAGTGTGG - Intergenic
1159687229 18:71437822-71437844 CAGAGGAACCTGATTTAGTGTGG + Intergenic
1162423763 19:10581599-10581621 CAGAGCAACAAGCTGGAGACGGG - Exonic
1163400300 19:17088119-17088141 TAGAGCCTCCAGAGGGAGTGTGG - Intronic
1166545439 19:43632143-43632165 CTGAGCAACCAGGTGGATGGTGG - Intronic
1167180741 19:47901535-47901557 CAGAGCCTCCAGAGGGAATGTGG + Intergenic
927433196 2:23044264-23044286 TAGAGCCCCCAGAAGGAGTGTGG + Intergenic
927777894 2:25916068-25916090 CAGAGTAACTAGATACAGTGTGG - Intergenic
928174675 2:29025701-29025723 CAGTGCTTCCTGATGGAGTGTGG + Intronic
928469189 2:31556665-31556687 CAGAGCTTCCAGAAGAAGTGTGG + Intronic
928620734 2:33085184-33085206 TAGAGCTGCCAGAGGGAGTGTGG + Intronic
930016698 2:46975573-46975595 CAGACCCACCACAGGGAGTGGGG - Intronic
930597233 2:53403513-53403535 CAGAGCCTCCATCTGGAGTGGGG - Intergenic
930611840 2:53553524-53553546 CAGAGGCACCACATGGAGTAGGG + Intronic
930858669 2:56045930-56045952 CAGGGGAACCAGGTGAAGTGTGG + Intergenic
931083844 2:58807065-58807087 AAGAGCTATCAGTTGGAGTGAGG + Intergenic
931722487 2:65077429-65077451 CAGAGCAAAGACATGGAGGGAGG + Intronic
932106291 2:68945752-68945774 CAGAGCAACCAGAGTGAAAGAGG - Intronic
932842733 2:75098954-75098976 CAGAACCAGCAGGTGGAGTGAGG + Intronic
935205029 2:100889980-100890002 TAGAGCAACTAGAAGGATTGAGG + Intronic
936845457 2:116825445-116825467 GAAAGCAATCTGATGGAGTGAGG + Intergenic
937096690 2:119240360-119240382 CCCTGCAGCCAGATGGAGTGGGG - Intronic
938219674 2:129554604-129554626 CAGAGCACACAGCTGGAGAGAGG - Intergenic
938313585 2:130311269-130311291 CAGGGAATCCAGAGGGAGTGAGG - Intergenic
939470582 2:142615562-142615584 CAGAGCAAGCAGAAGCAATGTGG + Intergenic
940855798 2:158727813-158727835 CAGAGCTTCCAGATGGAGTCAGG - Intergenic
941013309 2:160325955-160325977 CAGAACAACCAAATGAAATGGGG - Intronic
942589828 2:177530759-177530781 CAGAGAAAACAGATGTAGTCTGG + Intronic
945378635 2:209111522-209111544 CAGCCCAACCAGATAGATTGTGG + Intergenic
947541610 2:230983763-230983785 TAGAGCCTCCAGAGGGAGTGTGG - Intergenic
1169720249 20:8668162-8668184 CAGGGAAACCAGATTAAGTGAGG + Intronic
1169843302 20:9963073-9963095 AAGAACAACCAGATGGGGAGGGG + Intergenic
1171318739 20:24220356-24220378 CAGAGCAGCTAGATACAGTGTGG + Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1173013818 20:39207270-39207292 CGGAGCAGGCATATGGAGTGGGG + Intergenic
1174188204 20:48721918-48721940 CTGAGCAACCAGAAGGACAGAGG + Intronic
1175240757 20:57546578-57546600 CAGAGCCACCACACTGAGTGCGG + Intergenic
1175285635 20:57834897-57834919 CAGAGCCTCCAGAGGGAGTACGG - Intergenic
1175354136 20:58349222-58349244 CAGAGCAACCAAATGCAGTCAGG + Intronic
1178581114 21:33839423-33839445 GGGAGGAGCCAGATGGAGTGGGG + Intronic
1179128244 21:38611447-38611469 CAGGGCGGCCAGATGGAGAGAGG - Intronic
1179979160 21:44887545-44887567 AGGAGCAACCACAGGGAGTGAGG - Intronic
1180465055 22:15603473-15603495 CACAGCAGCGAGATGGAGAGAGG + Intergenic
1180792698 22:18585209-18585231 CAGAGAATCCGGAGGGAGTGAGG - Intergenic
1181229039 22:21410110-21410132 CAGAGAATCCGGAGGGAGTGAGG + Intergenic
1181249612 22:21524755-21524777 CAGAGAATCCGGAGGGAGTGAGG - Intergenic
1181925367 22:26354404-26354426 CACAGCATTCAGAGGGAGTGTGG + Intronic
1182409077 22:30167070-30167092 TAGAGCCCCCAGAGGGAGTGTGG - Intronic
1183013707 22:34968853-34968875 CATAGCAACCCGATGAAGTTAGG - Intergenic
1183148953 22:36021974-36021996 ATGAGCAGACAGATGGAGTGAGG - Intronic
1183332879 22:37230683-37230705 CTGAGAAACCAAAGGGAGTGGGG + Intronic
1183373895 22:37450997-37451019 GAGAGCAGCCAGATGGGGTGAGG + Intergenic
1183514925 22:38259629-38259651 CAGAGCCTCCAGAAGGAGTATGG + Intronic
1184194279 22:42916384-42916406 CAGAGCAACAACCTGGGGTGGGG + Intronic
1184428017 22:44424449-44424471 CAGAGCAGAAAGATGGAGAGAGG - Intergenic
1184664550 22:45981205-45981227 CAGAAGAACCCCATGGAGTGTGG - Intergenic
1184870331 22:47233693-47233715 CAGAGCCACAGGCTGGAGTGGGG + Intergenic
1185188704 22:49418925-49418947 TAGAGCCTCCAGAAGGAGTGTGG - Intronic
949362176 3:3243622-3243644 CATAGCCTCCAGAGGGAGTGTGG + Intergenic
950766032 3:15273745-15273767 CAGAGGGACCAGTTGTAGTGAGG - Intronic
951748965 3:26012618-26012640 CAGATCAGCCAGAAGGTGTGCGG - Intergenic
952086501 3:29828248-29828270 AAGAGCCACCAGACGGAGAGAGG - Intronic
954652140 3:52171651-52171673 CAGAGGGCCCAGATAGAGTGGGG + Intergenic
955029594 3:55203514-55203536 CTGAGGAAGCAGATGGGGTGTGG - Intergenic
955920026 3:63945948-63945970 CAGAGTAACCAGATGCAGAGAGG + Intronic
956623517 3:71244933-71244955 CAGAGCCCTCAGATGAAGTGAGG + Intronic
958718561 3:97818161-97818183 AAAAGCAAGCAGATGGATTGGGG - Intergenic
959484310 3:106909175-106909197 CAGAGCTACCAGCTGCAGAGAGG + Intergenic
959950545 3:112175578-112175600 CAGAGCGCCCAGAGGGAGGGTGG - Intronic
960487105 3:118267276-118267298 CAGAACAACCCTATGGAGTTAGG + Intergenic
960555937 3:119030727-119030749 CAGATCCTCCAGATGGTGTGGGG + Intronic
961048633 3:123727277-123727299 CAGACCACCCAGAAGGTGTGGGG + Intronic
961317373 3:126049827-126049849 TAGAGCTTCCAGAGGGAGTGAGG - Intronic
961359567 3:126358295-126358317 CTGAGGATCCAGCTGGAGTGTGG - Intergenic
961746616 3:129068016-129068038 CAGAGTAGCTAGATAGAGTGTGG + Intergenic
963074376 3:141332690-141332712 AAGAGCCTGCAGATGGAGTGGGG + Intronic
964655979 3:159066590-159066612 CAGGGCAGTCAGGTGGAGTGGGG + Intronic
964729454 3:159849715-159849737 TAGAGCATCCAGGTGGGGTGTGG + Intronic
966147304 3:176826502-176826524 TAGAGCTTCCAGATGGAGGGTGG - Intergenic
968472287 4:787663-787685 CAGAGCCTCCAGAGGGAGTGTGG + Intronic
968538649 4:1151022-1151044 CAGGGCAACCAGATGCAGAGAGG - Intergenic
968974663 4:3815475-3815497 CAGTACAGCCTGATGGAGTGGGG - Intergenic
969633742 4:8353334-8353356 CAAAGCCACCCTATGGAGTGGGG - Intergenic
969834295 4:9827311-9827333 CAAAGCAAGCAGATTGATTGAGG - Intronic
970184376 4:13434161-13434183 AAGAGGAGACAGATGGAGTGGGG + Intronic
970439264 4:16066072-16066094 CAGAGCCTTCAGATGGAGCGTGG + Intronic
971011835 4:22446502-22446524 AAGAGAAACAAGATGGAGTATGG + Intronic
971283885 4:25268155-25268177 CTGAGGAACCAGATAGACTGAGG + Intronic
971771366 4:30901285-30901307 CAGAAAAACCAGATAGAGAGAGG + Intronic
972336630 4:38112818-38112840 CAGGTCACACAGATGGAGTGTGG - Intronic
972382188 4:38529485-38529507 CTGAGGAACCACAAGGAGTGTGG + Intergenic
973646389 4:52955032-52955054 AGTAGCCACCAGATGGAGTGAGG - Intronic
975582892 4:75922534-75922556 CAGTGCTAATAGATGGAGTGGGG - Intronic
975632782 4:76419519-76419541 CAGAGCCTCCAGAGGGAGGGAGG - Intronic
975635823 4:76446922-76446944 CAGAGCAGACAGATTGAGCGTGG - Intronic
975912411 4:79282588-79282610 TAGAGCAAACAGATAGATTGTGG + Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976447328 4:85146249-85146271 CAGAGCCACAAGATGGAAAGAGG - Intergenic
977570142 4:98620711-98620733 CACTGCAATCAGAGGGAGTGTGG + Intronic
978315475 4:107431090-107431112 CACAGCAACCACATAGAGTAGGG - Intergenic
979573545 4:122258744-122258766 CAGAGCTACCAGGTGGAGGCCGG - Exonic
979733460 4:124053116-124053138 CAGAGCTTCCAGAGGGAATGTGG - Intergenic
980243227 4:130203234-130203256 CAGTGCAACCAGCTGCAGAGAGG + Intergenic
980670692 4:136002037-136002059 CTGAGCCACCAGATAGAGTTTGG - Intergenic
981778511 4:148397945-148397967 CAGAGCCTTCAGAGGGAGTGTGG - Intronic
981960782 4:150536178-150536200 CAGAACAACCAGATACAATGAGG + Intronic
983463848 4:168061490-168061512 TAGAGCTTCCAGAGGGAGTGTGG - Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986942807 5:12975903-12975925 CAGAGAAAACACCTGGAGTGAGG - Intergenic
988713908 5:33805566-33805588 CAGACCATCCTAATGGAGTGAGG + Intronic
988943877 5:36174686-36174708 CAGAGTAACCAGATAGAATGTGG + Intronic
990302053 5:54459137-54459159 CAGAGCCAGCAGATGAAATGCGG - Intergenic
992075103 5:73184815-73184837 GAGAGCCTCCAGATGGAGTGTGG + Intergenic
992508640 5:77412077-77412099 CTGAGCAAACAGATGGGATGGGG - Intronic
992678182 5:79126763-79126785 GAGACCAAGCAGATGAAGTGAGG + Intronic
993962456 5:94316613-94316635 CAGGACAGCCAGATGGGGTGAGG - Intronic
994885611 5:105557621-105557643 CAGAGCAACCAGAGTGCCTGGGG + Intergenic
996638757 5:125728258-125728280 CAGAGCAAAGGGATGGAGAGTGG + Intergenic
996657560 5:125959830-125959852 CAGACCAATCAAATGGACTGTGG - Intergenic
997761444 5:136452085-136452107 CAGAGCAACCCTATGGGGTGGGG - Intergenic
998471947 5:142390342-142390364 CAGAGCCCCCAGAGGAAGTGAGG - Intergenic
999959119 5:156735375-156735397 CAGAGCTCCCAGAGGCAGTGGGG - Intronic
1000028754 5:157383313-157383335 CAGAGGGACCAGGTGGAGCGGGG - Exonic
1002939964 6:1707503-1707525 GTGAGCAACCAGATGGAGGTGGG + Intronic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1003673032 6:8177471-8177493 CACAGCACCATGATGGAGTGGGG - Intergenic
1006033732 6:31196028-31196050 CAGAGCAGCTAGATAGAGTGTGG - Intergenic
1006661411 6:35648714-35648736 CAGAGCAGCCAGATGACTTGAGG + Intronic
1007143072 6:39596147-39596169 CAGGTCAACCAGATGGAGTTTGG + Exonic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007280099 6:40705735-40705757 CAGAGCAACCCTATGGGGTAGGG + Intergenic
1007524234 6:42477549-42477571 CAAAGGGAGCAGATGGAGTGAGG + Intergenic
1007686604 6:43670794-43670816 TGGAGCATCCAGATGGAGAGGGG + Exonic
1008500545 6:52176817-52176839 CATTGCAACCACATGTAGTGAGG - Intergenic
1009197041 6:60699270-60699292 TAGAGTACCCAAATGGAGTGTGG - Intergenic
1009566994 6:65322222-65322244 GAGAGGAACCAGATGAAATGAGG + Intronic
1009898380 6:69780961-69780983 AAGAGAAACCAGGTGGAGAGAGG + Intronic
1010301662 6:74267512-74267534 CAGAGAAACAAGATACAGTGAGG + Intergenic
1012372965 6:98529640-98529662 GAGAGCACCCATAGGGAGTGAGG + Intergenic
1013270582 6:108542170-108542192 CACAGCCACCAGATGGCGGGAGG + Intergenic
1013375568 6:109510427-109510449 CAGAACAACCAGTTGCAGAGAGG + Intronic
1018394805 6:163370050-163370072 CAGAGCAGCAGGATGGGGTGAGG - Intergenic
1018684622 6:166294357-166294379 CAGAGCAACCAGTTGGGGTTTGG - Intergenic
1020883838 7:13797894-13797916 GAGGGCCACCAGATAGAGTGGGG + Intergenic
1022505676 7:30907583-30907605 CAGAGAACCCTGATGGAGGGTGG - Intergenic
1023155582 7:37248420-37248442 CAGAGAAAGCAAAAGGAGTGAGG + Intronic
1024227301 7:47335666-47335688 CAGAGCATCCATATGAAGGGCGG - Intronic
1024292999 7:47819203-47819225 CAGAGCACCCAGAGGCAGTGAGG + Intronic
1028715067 7:93956373-93956395 CAAAGCAACCAGAAAGGGTGGGG - Intergenic
1030078338 7:105755923-105755945 CAGACCAGACACATGGAGTGGGG - Intronic
1032150666 7:129426828-129426850 CATAGCAACAAGATGAAATGGGG - Intronic
1034254807 7:149719074-149719096 CAGAGCCTTCAGAGGGAGTGTGG - Intronic
1035589503 8:802149-802171 CAGAGGACCCAGGAGGAGTGCGG - Intergenic
1035726000 8:1824834-1824856 CAGAGTAAACAGGTGGGGTGTGG - Intronic
1035726051 8:1824994-1825016 CAGAGTAAACAGGTGGGGTGTGG - Intronic
1036752787 8:11453945-11453967 CACAGCAACCCCAAGGAGTGTGG - Intronic
1037109165 8:15145135-15145157 CAGAGAAGCCAGAAGGACTGAGG - Intronic
1037846949 8:22291930-22291952 CAGGGCAATCAGAAGTAGTGGGG + Intronic
1038834954 8:31109116-31109138 CAGAACTACCAGCTGTAGTGTGG + Intronic
1038848530 8:31252026-31252048 GAGAGAAAGCAGATGGAGAGCGG - Intergenic
1039102618 8:33957452-33957474 CAGAGCTCCCAGTAGGAGTGGGG - Intergenic
1041005204 8:53491453-53491475 CAGAGCCCCCAGAGGGAGTATGG - Intergenic
1041284002 8:56241892-56241914 AAGAACAACAAGATTGAGTGAGG + Intergenic
1041782597 8:61593956-61593978 CAAACTAACAAGATGGAGTGAGG + Intronic
1042259921 8:66848123-66848145 CAGAGCTACCAGCTGAACTGGGG - Intronic
1042426002 8:68649666-68649688 AACAGCTACCAGAAGGAGTGAGG - Intronic
1043476145 8:80607813-80607835 CAGAGCCACCACATTGACTGTGG + Intergenic
1044233095 8:89801353-89801375 CAGGGCAACCAAATGTAATGTGG - Intergenic
1044826987 8:96208189-96208211 CAAAGCTTCCAGAAGGAGTGTGG - Intergenic
1044952981 8:97451630-97451652 CAATGGCACCAGATGGAGTGAGG - Intergenic
1045493817 8:102691194-102691216 CAGAGGAAACAGATGGGTTGTGG + Intergenic
1045545141 8:103121980-103122002 GAGAACAACCAGAGAGAGTGTGG + Intergenic
1046957848 8:120080116-120080138 CTCTGCAACCAGAAGGAGTGAGG - Intronic
1047773957 8:128053811-128053833 CTGAGCAACCAGAAGGGTTGGGG + Intergenic
1047957326 8:129985662-129985684 CAGAGCAAATAGAGTGAGTGTGG + Intronic
1048804630 8:138228658-138228680 AAGAGCAACCAGAAGTTGTGGGG - Intronic
1050599653 9:7237627-7237649 CAGAGTAACAAGAGAGAGTGTGG + Intergenic
1053393065 9:37750166-37750188 TATGGCAAACAGATGGAGTGGGG + Intronic
1055722060 9:79186195-79186217 CAGAGCTTCCAGAAGGAATGTGG - Intergenic
1055991503 9:82111145-82111167 TAGAGCCTCCGGATGGAGTGTGG + Intergenic
1056273671 9:84971726-84971748 CAGAGTAAGCAGATGGGCTGAGG + Intronic
1056971569 9:91209167-91209189 CAGAGCAACAAGCAGAAGTGGGG + Intergenic
1057442522 9:95092322-95092344 CAGAGCAGCCAGATGCTGGGTGG - Intergenic
1057540203 9:95960630-95960652 TAGAGCCTCCAGAAGGAGTGTGG + Intronic
1057873122 9:98732964-98732986 CAGAGGAGAGAGATGGAGTGGGG - Exonic
1058552404 9:106128948-106128970 CAGAGCTACGAGATGGAGGAGGG + Intergenic
1058961639 9:109997775-109997797 AAGAGCCACCACCTGGAGTGGGG + Intronic
1060994430 9:127868101-127868123 CTGAGTCACCAGGTGGAGTGGGG + Intronic
1062560119 9:137137896-137137918 GAGAGCCAACAGAAGGAGTGAGG + Intergenic
1187662561 X:21566019-21566041 CAAAGCAACAGGATAGAGTGCGG - Intronic
1188981160 X:36728445-36728467 TAGAGGAACCAGAAGCAGTGTGG - Intergenic
1189380212 X:40497322-40497344 TAGAGCCTCCAGATGGAGTGTGG + Intergenic
1190284042 X:48950428-48950450 GAGAGCTTCCAGAAGGAGTGTGG + Intronic
1191853254 X:65601812-65601834 CAGAGGAAACAGATAGACTGAGG - Intronic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1194352516 X:92838639-92838661 CAGACCCACGAAATGGAGTGGGG + Intergenic
1195353158 X:104013467-104013489 CAGAGCAAGCAGAGGAAGCGAGG - Exonic
1196614739 X:117755192-117755214 CAGAGTAATAAAATGGAGTGGGG + Intergenic
1197286672 X:124603120-124603142 CAGAGTCTCCAGAGGGAGTGTGG + Intronic
1198517089 X:137420535-137420557 TTGAGCAACCAGATGGATGGTGG - Intergenic
1198718341 X:139587090-139587112 CACAGCAAGCAGATGCTGTGTGG + Intronic
1199019992 X:142868173-142868195 GAGAGCATGCAGATGGACTGGGG + Intergenic
1200285965 X:154822554-154822576 CAGAGAAACCAGATTAAGCGAGG - Intergenic
1200660828 Y:5955378-5955400 CAGACCCACGAAATGGAGTGGGG + Intergenic
1201236252 Y:11914725-11914747 TAGAGCCACCAGAAGGAATGGGG + Intergenic