ID: 911615752

View in Genome Browser
Species Human (GRCh38)
Location 1:100008985-100009007
Sequence CTGTAAGTACAGATGACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911615752 Original CRISPR CTGTAAGTACAGATGACTCC TGG Intronic
904965469 1:34369279-34369301 CTGTGAGTCCACTTGACTCCTGG - Intergenic
905052692 1:35065556-35065578 CTTTAAATACAGTTGACTCTTGG - Intronic
906350813 1:45057404-45057426 AAGTAAGTAGAGATGGCTCCTGG - Intronic
907581499 1:55576387-55576409 CTGGAAGAACAGCTGAGTCCAGG + Intergenic
909550264 1:76891932-76891954 TTGTAAGTACATATGATGCCTGG - Intronic
911420861 1:97638788-97638810 CTGTAAGTTCACATGAGACCTGG - Intronic
911615752 1:100008985-100009007 CTGTAAGTACAGATGACTCCTGG + Intronic
917754199 1:178083100-178083122 CTGTAGCAGCAGATGACTCCAGG + Intergenic
920422356 1:205843727-205843749 CTGCAAGTAAACATGACTTCAGG - Exonic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
921481660 1:215671165-215671187 CTGGAGGTACAAATGGCTCCAGG - Exonic
924354394 1:243154887-243154909 CTGTATGTCTAGATGCCTCCTGG - Intronic
1067271737 10:44797431-44797453 CTGTCAGTCCAGGTGGCTCCAGG + Intergenic
1069269337 10:66505451-66505473 ATGTAATCACAGATGACTCAGGG + Intronic
1071166768 10:82816465-82816487 CTGTGAGTCCAGCTGAGTCCAGG + Intronic
1074376747 10:112947054-112947076 CTGTGGATACTGATGACTCCTGG - Intergenic
1074384185 10:113004167-113004189 CTGTAAGTAGAGAAGTCTCCGGG + Intronic
1074791096 10:116888469-116888491 CTGTCAGAACAGCTGACTGCAGG - Intronic
1075848358 10:125565520-125565542 CATTAAGTACTGATCACTCCAGG + Intergenic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1077739594 11:4830746-4830768 GTGTCAGTAAAGCTGACTCCAGG + Intronic
1078338895 11:10485123-10485145 CTTTAAGTACAGGGGACCCCAGG - Intronic
1079110684 11:17603485-17603507 CTCTAAGGCCAGGTGACTCCGGG - Intronic
1080999690 11:37653593-37653615 ATGAAAGTACAGATAACTCTTGG - Intergenic
1082908918 11:58347553-58347575 CTGAAAGTCAACATGACTCCAGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086411873 11:86551955-86551977 GTGCAAGTACAGATGATTTCAGG + Intronic
1089678224 11:120104822-120104844 CTGTGAGCCCAGAGGACTCCAGG + Intergenic
1094457262 12:30650439-30650461 ATGTAAATACAGTTGACTCTTGG - Intronic
1094801909 12:34047610-34047632 CTGCAAGAACAAATGACTGCAGG + Intergenic
1095115039 12:38343515-38343537 CTGCAAGAACAAATGACTGCAGG + Intergenic
1100019067 12:90047919-90047941 CTTTAGGCACAGATGGCTCCAGG - Intergenic
1102579839 12:113879324-113879346 CCTTAGGTACAGATGACCCCAGG - Intronic
1105205446 13:18219514-18219536 CTCTAATTACAGGTGACTTCAGG + Intergenic
1105660306 13:22487093-22487115 CTGGATTTACAGATGTCTCCTGG + Intergenic
1106695853 13:32171853-32171875 TTGTAAGAACAAATGACTACAGG + Intronic
1107982010 13:45742957-45742979 CTCTAACTACAGATGACTCTTGG + Intergenic
1109674436 13:65655716-65655738 CATTAAGTACAAATGAATCCTGG + Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1115541104 14:34422200-34422222 CTGTAAAGAAAGATGACACCTGG + Intronic
1118313562 14:64709983-64710005 CTGTCAGAACAGCTGACTACAGG - Intronic
1119331448 14:73797347-73797369 CTGTGTGTACAGATGTCACCTGG + Intergenic
1119697348 14:76723825-76723847 CTGTATGTACAGATTTCTCTTGG - Intergenic
1121432429 14:93897297-93897319 CTGCAGGTACAGCTGGCTCCAGG - Intergenic
1122862295 14:104588036-104588058 CTGTGTGTCCAGATGACCCCAGG - Intronic
1124033588 15:26032994-26033016 CGGTAGGTACAGATGCTTCCAGG - Intergenic
1124665300 15:31586973-31586995 ATCTAAATACTGATGACTCCTGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127370333 15:58332902-58332924 CTTTAAGGAGAGATGACTGCTGG + Intronic
1127680779 15:61295784-61295806 CTGGAAGTACCGGTGACTTCTGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135244835 16:20846570-20846592 CAGTAAGGACATAAGACTCCTGG - Intronic
1135322539 16:21506973-21506995 CTGTCATTACAAATGACTCCTGG - Intergenic
1136334018 16:29600111-29600133 CTGTCATTACAAATGACTCCTGG - Intergenic
1140381566 16:74492957-74492979 CTCTGTGTACAGCTGACTCCAGG + Exonic
1140888362 16:79264047-79264069 CTGTAAATGGAGAAGACTCCAGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142034780 16:87856201-87856223 CTGTCATTACAGATGACTCCTGG - Intronic
1143767138 17:9145165-9145187 GTGGAATTACAGAGGACTCCTGG + Intronic
1144607201 17:16677401-16677423 CTGTGAGTGCAGATGGCTCAGGG + Intergenic
1144863237 17:18318848-18318870 CAGAAGGGACAGATGACTCCGGG + Intronic
1145963371 17:28900700-28900722 CAGTCAGTGCAGATGGCTCCTGG + Intronic
1146544712 17:33728219-33728241 CTGTAAGTTCATGTGGCTCCAGG + Intronic
1146956934 17:36941383-36941405 CTGGAAGCAGAGCTGACTCCCGG - Intronic
1149459245 17:56813604-56813626 ATTTAAGAACAGATGACTTCAGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150750806 17:67861011-67861033 CTGTATGTCCAGCAGACTCCTGG + Intronic
1150793389 17:68218663-68218685 CTGTATGTCCAGCAGACTCCTGG + Intergenic
1152025250 17:77804769-77804791 CTGTAAGGAAAGATGACTGCTGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155848490 18:30739651-30739673 CTTTTAGAACATATGACTCCTGG + Intergenic
1155872705 18:31047039-31047061 CTGTATGTTCACATGTCTCCAGG + Intergenic
1159089146 18:63827193-63827215 CAGTAAGGACAAAAGACTCCAGG + Intergenic
1167824825 19:51962598-51962620 TTGTAAGCACAGAATACTCCAGG - Intergenic
1202632989 1_KI270706v1_random:17055-17077 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1202652886 1_KI270707v1_random:22995-23017 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1202659265 1_KI270708v1_random:52749-52771 CTGTAACTATAGCTGAGTCCTGG - Intergenic
928477731 2:31647704-31647726 CTGTATGTACAGAGCACTTCTGG - Intergenic
928740517 2:34346817-34346839 TATTAAGTACAGATGACTCTTGG - Intergenic
930090075 2:47525556-47525578 CTTGAAGTACAGATGGCCCCTGG - Intronic
930332300 2:50000833-50000855 CTGGAGGTACAGATGAGTTCTGG + Intronic
930724042 2:54665446-54665468 CTGTAAGTGCTGATGGCTCTGGG + Intronic
937271030 2:120652827-120652849 CTGTAAGTAGGGAGGGCTCCTGG - Intergenic
938725710 2:134107311-134107333 GTGTAAATTCACATGACTCCAGG + Intergenic
940242372 2:151577277-151577299 ATGGAAGTACAGATGACACGAGG - Intronic
946469664 2:219946947-219946969 CTCTAAGAATTGATGACTCCAGG + Intergenic
947073661 2:226318598-226318620 ATTATAGTACAGATGACTCCTGG - Intergenic
1176114437 20:63425129-63425151 CTGTAAGGACAGCTGTCACCGGG + Intronic
1176599266 21:8776656-8776678 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1176645209 21:9342935-9342957 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178751778 21:35311562-35311584 CTGTAATTAGAAATTACTCCAGG + Intronic
1180326727 22:11436274-11436296 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1180367742 22:11956299-11956321 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1180419162 22:12798244-12798266 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1180760528 22:18199204-18199226 CTCTAATTACAGGTGACTTCAGG - Intergenic
1180770841 22:18383501-18383523 CTCTAATTACAGGTGACTTCAGG - Intergenic
1180775141 22:18425492-18425514 CTCTAATTACAGGTGACTTCAGG + Intergenic
1180808216 22:18736547-18736569 CTCTAATTACAGGTGACTTCAGG + Intergenic
1181071140 22:20341512-20341534 CTCTAATTACAGGTGACTTCAGG + Intergenic
1181194211 22:21170461-21170483 CTCTAATTACAGGTGACTTCAGG + Intergenic
1181215230 22:21322317-21322339 CTCTAATTACAGGTGACTTCAGG - Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1203232675 22_KI270731v1_random:124673-124695 CTCTAATTACAGGTGACTTCAGG - Intergenic
949352399 3:3137584-3137606 CTGCAAGAACAGAGGACTGCAGG - Intronic
951397696 3:22189912-22189934 CTGTAAGTAGAGCTCACTTCTGG - Intronic
956302182 3:67784085-67784107 CTGTAAGTACACAAGAATCCAGG - Intergenic
957095109 3:75771109-75771131 CTGTAACAACAGCTGAGTCCTGG + Intronic
957715160 3:83918986-83919008 CTGTAAGAAAACATAACTCCAGG - Intergenic
961072345 3:123944798-123944820 CTGTATGCAAAGATGTCTCCTGG - Intronic
963157676 3:142116871-142116893 CTGTAAGTTCAGTTGACTCTTGG + Intronic
965467727 3:169053254-169053276 CCGTAGTTACAGATGACTCCAGG - Intergenic
1202741681 3_GL000221v1_random:62133-62155 CTGTAACTATAGCTGAGTCCTGG + Intergenic
971175233 4:24276315-24276337 CTGTAAGTCCACATGCATCCAGG + Intergenic
973362629 4:49179029-49179051 CTGTAACTATAGCTGAGTCCTGG - Intergenic
973398474 4:49617824-49617846 CTGTAACTATAGCTGAGTCCTGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
977657617 4:99540500-99540522 CAGTAAGTACTAATGACTCAGGG + Intronic
978885165 4:113760590-113760612 CTGTAAATAGAGATGCCTCCTGG - Intronic
979247411 4:118524758-118524780 CTGTATGTCTAGATGCCTCCTGG + Intergenic
979635556 4:122951622-122951644 CTGTGAGTACACAGGACTGCTGG + Intronic
980014815 4:127636958-127636980 CTGGAAGTAGAGATGACAGCAGG - Intronic
982426922 4:155274996-155275018 CTGTAGGTACAGATTACTTGTGG + Intergenic
993594056 5:89830614-89830636 ATGTAATTAAAGATTACTCCAGG + Intergenic
994575511 5:101574125-101574147 CTTTGAGTATAGATGTCTCCAGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
997388597 5:133495363-133495385 CTGTTAGAACAGCTGCCTCCTGG - Intronic
998190709 5:140021919-140021941 CTGTAAGGGCAGAGGACTCCTGG - Intronic
1001329731 5:170753886-170753908 CAGCAGGTACAGATGACACCTGG + Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1005655709 6:27934810-27934832 CAGTAGGTACAGATGATGCCAGG + Intergenic
1010562032 6:77362517-77362539 CTCTATCTGCAGATGACTCCAGG - Intergenic
1014263275 6:119245537-119245559 CTGGAAGTACAGCTGATTCAAGG + Intronic
1017045010 6:150338726-150338748 CTGCAAGTACATATGACTTCAGG + Intergenic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1022069898 7:26902554-26902576 CTGTAAGTAGAAATGAATACAGG - Intronic
1022562814 7:31367399-31367421 CTTTAACTACAGATGATTGCTGG - Intergenic
1026141821 7:67713121-67713143 CTGTGGGGAGAGATGACTCCTGG + Intergenic
1026523177 7:71133276-71133298 ATGTCAGTACAGTTGGCTCCCGG + Intronic
1028477850 7:91270461-91270483 CTGTAAGTACTGAAGCCTTCTGG + Exonic
1028771012 7:94621517-94621539 CTGTAGATACAGATTACTCAAGG - Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030025447 7:105319699-105319721 CTGTAAATACAGCTGAGTCCTGG + Intronic
1030968059 7:116018358-116018380 CAGTTATTACAGATGGCTCCAGG + Intronic
1031589182 7:123569112-123569134 CTGTAAGTACTGAGGATTCTGGG + Intronic
1034952432 7:155308378-155308400 CTGACTGTACAAATGACTCCTGG + Exonic
1036647942 8:10623727-10623749 CTGTAAGTGCATATGACTCTAGG - Intronic
1037887093 8:22600920-22600942 CTGTAGGTGCTGGTGACTCCAGG - Exonic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1050036876 9:1445540-1445562 CTGGAAGTACAGATGAGAACTGG - Intergenic
1051062805 9:13064668-13064690 ATTTAAGTACAGAGGACTCAGGG - Intergenic
1059216342 9:112567422-112567444 CTGGAACTACAGAGGCCTCCTGG - Intronic
1061575055 9:131501159-131501181 CTGTAAATACAGTTGCCTGCAGG + Intergenic
1062315119 9:135963300-135963322 CTGTAGGTCCAGCTGCCTCCAGG - Intergenic
1062721789 9:138048348-138048370 CTGTAGGTACACATGGCCCCAGG - Intronic
1203691757 Un_GL000214v1:48716-48738 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1203710313 Un_KI270742v1:92057-92079 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1203644538 Un_KI270751v1:55475-55497 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187121678 X:16413828-16413850 ATGTAAATACAGTTGACTCTTGG - Intergenic
1188818016 X:34739303-34739325 CAGTAAGCACAGGTGATTCCAGG + Intergenic
1190062818 X:47221973-47221995 CTGTGAGTCCAGATGGTTCCTGG + Intronic
1194795675 X:98209028-98209050 CTGTAAGTACAGAGTAATCAAGG - Intergenic
1194806546 X:98335811-98335833 CTGTAACTACAGATGAGACCAGG - Intergenic
1198497409 X:137206203-137206225 CTAAAAATACAGATGTCTCCAGG - Intergenic