ID: 911616694

View in Genome Browser
Species Human (GRCh38)
Location 1:100020646-100020668
Sequence CACAGTGAATGAAGAGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911616691_911616694 4 Left 911616691 1:100020619-100020641 CCTATATATGCTAGGCACTGTGG No data
Right 911616694 1:100020646-100020668 CACAGTGAATGAAGAGCATATGG 0: 1
1: 0
2: 2
3: 29
4: 255
911616690_911616694 5 Left 911616690 1:100020618-100020640 CCCTATATATGCTAGGCACTGTG 0: 1
1: 1
2: 15
3: 183
4: 1122
Right 911616694 1:100020646-100020668 CACAGTGAATGAAGAGCATATGG 0: 1
1: 0
2: 2
3: 29
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911616694 Original CRISPR CACAGTGAATGAAGAGCATA TGG Intronic
900418812 1:2546833-2546855 CACGGTGAATGAAGAGCAACGGG + Intergenic
901210261 1:7520554-7520576 CACAGAGAGGGAAGAGCACATGG + Intronic
902119301 1:14148295-14148317 CACAGAGAAAGAAGAGAACAGGG - Intergenic
902191824 1:14769101-14769123 CACTGTGAATGGACAGCAAAGGG - Intronic
902198629 1:14817192-14817214 CACAGTACATGATGAGCACAAGG - Intronic
903679170 1:25085650-25085672 CACAGTGTGAGAAGAGCACATGG - Intergenic
904745146 1:32706059-32706081 CACAGTATAAGAAGAGCTTATGG + Intergenic
907666787 1:56439916-56439938 CTCAGTGAATAAGGAGCACAAGG - Intergenic
909273420 1:73653785-73653807 CACAGTGCATAATGAGAATATGG - Intergenic
911616694 1:100020646-100020668 CACAGTGAATGAAGAGCATATGG + Intronic
911810974 1:102280637-102280659 CACAGTAATAGAAGAGGATAGGG + Intergenic
912160839 1:106982940-106982962 ATCAGTGAGTGAAGAGCAAAAGG + Intergenic
912891331 1:113534937-113534959 CCCAGTGACTGAATACCATATGG - Intronic
913406299 1:118495776-118495798 CACGGTGAAGGAGGAGCAGAGGG + Intergenic
916182104 1:162094281-162094303 TAAATGGAATGAAGAGCATAGGG - Intronic
916452703 1:164936296-164936318 AACAGTAAGTGAAGAGTATATGG + Intergenic
916840801 1:168598447-168598469 CATAGTTATTAAAGAGCATACGG + Intergenic
917726653 1:177834182-177834204 CATGGTGAATGAAGAGGAAAGGG + Intergenic
918225398 1:182476798-182476820 CACAGTTGATGATGAGCATGGGG - Intronic
918532239 1:185536870-185536892 CACAATGAATGGAGAGGCTATGG - Intergenic
919086743 1:192929561-192929583 CACAGTGAAAGAAAAGCAGGAGG + Intergenic
919944874 1:202311831-202311853 CACAGTGTATGGAGGGCAAATGG + Intronic
920864646 1:209741763-209741785 CACATTGTAAGAAGAGCATGTGG + Intergenic
921518649 1:216130706-216130728 CACATTGATTGAAGGGCATTTGG + Intronic
921889510 1:220339734-220339756 CACAAGGAATGAAATGCATAAGG - Intergenic
922175449 1:223193669-223193691 CACATTGTAAGAAGAGCTTATGG - Intergenic
922308442 1:224365290-224365312 CACAGTCAACAAATAGCATAGGG + Intronic
922349605 1:224724383-224724405 CAGAGTGATTAAAGAGCATGTGG + Intronic
924565717 1:245196515-245196537 CACAGTCAATGAAGGGGATATGG - Intronic
924686928 1:246302373-246302395 CACATTGAATGAAGCACAAAAGG - Intronic
924869158 1:248022016-248022038 CAAAGAGAATGAAGAGGAAAAGG - Exonic
1064315660 10:14253716-14253738 CAAGGTGAAGGAAGAGCAAATGG - Intronic
1066088217 10:31991689-31991711 CACAGTGAAAGAAGAGCATCTGG + Intergenic
1066138354 10:32475321-32475343 AACAGTGAATGCAGTACATATGG - Intronic
1066566357 10:36725633-36725655 CACAGTGACAGAAGAACACAGGG + Intergenic
1068241820 10:54312401-54312423 CACATTATAAGAAGAGCATATGG - Intronic
1068280989 10:54869486-54869508 CACAGTGTATGTAGAGAATAGGG + Intronic
1071752903 10:88501875-88501897 AACAGGGAGTGAAGATCATATGG - Intronic
1072383817 10:94902914-94902936 CACAGAGACTGAAGATGATAGGG - Intergenic
1073346457 10:102786636-102786658 CACAGTGAATCAGGACAATAAGG - Intronic
1074558668 10:114515443-114515465 CACTCTGCATGAAAAGCATAAGG - Intronic
1075003825 10:118816743-118816765 CACACTGTAAGAAGAGCATAGGG + Intergenic
1077898027 11:6468671-6468693 CAGAGTGACTGAAGAGTAAATGG + Intronic
1078657516 11:13255499-13255521 CACAGTGAAGGAAGAGGCAAAGG + Intergenic
1078753816 11:14189978-14190000 CTCCTTGAATGAAGAGCATTTGG + Intronic
1079541429 11:21580490-21580512 CAGAGTCAATGGAAAGCATAAGG + Intergenic
1085774919 11:79357042-79357064 CAGAGTGAAAGAAGAGAAGAGGG - Intronic
1086604804 11:88684082-88684104 CACAATGAATGAAGAGGCTTTGG + Intronic
1086891786 11:92266845-92266867 CACAGAGAATGAAGATCATCAGG - Intergenic
1088101107 11:106156615-106156637 CACAGTATAGGAAGAGCATGGGG - Intergenic
1089302239 11:117505664-117505686 CACAGGGAATGTAGAGCAGCTGG + Exonic
1091971001 12:4786941-4786963 CACAGTGGATTGAGAGCAAAAGG - Intronic
1092316003 12:7414055-7414077 CACAATGAATGAAGGAAATATGG + Intronic
1093028831 12:14269495-14269517 CAAAGTGGATGGAGAGAATAAGG + Intergenic
1095702451 12:45204374-45204396 CACAGGGAAGGTAGAACATATGG - Intergenic
1097610102 12:61808795-61808817 CACAGTGCCTGCAGCGCATACGG + Intronic
1099885412 12:88523996-88524018 AACAGTGAAGGAACAGCACAGGG + Intronic
1100370626 12:93966016-93966038 CACAGTGAGTGAAGAGGGCACGG - Intergenic
1106647262 13:31649930-31649952 CAGATTGACTGAAGAGCAGATGG + Intergenic
1108884406 13:55162174-55162196 AGCAGTAAATGAAGAACATAAGG + Intergenic
1110077800 13:71271422-71271444 CACAGTGAATGAAGGACAAAAGG - Intergenic
1110109616 13:71728975-71728997 GACAGTGAATGGAAAGCATATGG + Intronic
1110587948 13:77216516-77216538 CATAATCAATGAAGAGCAGATGG + Intronic
1110790866 13:79585303-79585325 CACTTTGTAAGAAGAGCATATGG + Intergenic
1111552530 13:89833519-89833541 CACAGTGATTGAGGAGCACTTGG - Intergenic
1112050112 13:95636649-95636671 CACAGTGAATGTAGATTAGAAGG + Intronic
1112264071 13:97906502-97906524 CACAATGATTGGAGAACATAGGG - Intergenic
1113557261 13:111247923-111247945 CACAGGGAATGGAGAGGTTAGGG - Intronic
1114837003 14:26214357-26214379 CACAGTGAGTGGAGCACATATGG - Intergenic
1117564002 14:56975346-56975368 CACACAGAATGAAGAGGAAAGGG - Intergenic
1118968723 14:70613175-70613197 CATTGTGAATAAAAAGCATAAGG + Intergenic
1119281143 14:73409135-73409157 CATATTGTAAGAAGAGCATATGG - Intronic
1119520748 14:75283191-75283213 TAAACTGAATGAAGGGCATATGG - Intergenic
1119931841 14:78554935-78554957 CACAGATAATGAACTGCATAAGG - Intronic
1120225072 14:81781734-81781756 CATAGTGAATGATGAGAATCAGG - Intergenic
1120820988 14:88911706-88911728 GACAGTGAAGGCAGATCATAAGG + Intergenic
1120917276 14:89721143-89721165 CACCGTGAATAAAGAGCTTCGGG - Intergenic
1121662859 14:95648832-95648854 AAAAGTGAATGAAGAATATATGG + Intergenic
1125901817 15:43355287-43355309 CATAGAGAATGAAAAGCAAATGG + Intergenic
1126527572 15:49673994-49674016 CAAAATGAATGAATAGCATTAGG + Intergenic
1127387951 15:58482553-58482575 AACAGTCCATGAAAAGCATATGG + Intronic
1128676232 15:69610991-69611013 GACACTGAATGAAGAGCCTGGGG + Intergenic
1129959265 15:79668543-79668565 CACAGTTATTGAGGAGCATCTGG - Intergenic
1130399710 15:83538324-83538346 CACATTGAATGCAGGGCTTATGG + Intronic
1130816869 15:87445622-87445644 CAAAGAAAATGAGGAGCATACGG - Intergenic
1131371843 15:91888377-91888399 TTAAGTGAATGAAGAGCAAAGGG - Intronic
1131416429 15:92263504-92263526 AACAATGAATGAAGAGCATCAGG - Intergenic
1131855825 15:96593026-96593048 CACAGTGGAAGAAGACAATATGG + Intergenic
1133081384 16:3323394-3323416 CACAGTGATTGAGGAGCACCTGG - Intergenic
1134035503 16:11027533-11027555 CACAGTGATTGAGGAGCACCTGG + Intronic
1135179494 16:20260521-20260543 CACAGAGGCTGCAGAGCATATGG - Intergenic
1136654125 16:31699626-31699648 GACAGTGAATGAAGAGTGTCAGG - Intergenic
1141433960 16:83988041-83988063 AACTGTGATTGAACAGCATAAGG - Intronic
1141833659 16:86524011-86524033 CACTTTGAATGAAGAGCAGAAGG + Intergenic
1144669312 17:17123869-17123891 CACAGAGAAAGGAGAGCAAATGG - Intronic
1146449161 17:32958602-32958624 AGCAGTTAATGAAGACCATATGG + Intergenic
1146490230 17:33275819-33275841 CAGACTGAGGGAAGAGCATATGG + Intronic
1147488934 17:40845794-40845816 CCCAGTGAAGGAAGTGAATAAGG + Intergenic
1149168130 17:53778762-53778784 CACTGTGGATGATGAGAATAGGG + Intergenic
1152438651 17:80291607-80291629 CTCTGTGAATGAACAGGATACGG - Exonic
1153603477 18:6806701-6806723 TAATGAGAATGAAGAGCATAAGG - Intronic
1153992133 18:10410024-10410046 CCCAGGGAATGAAGAGTATGTGG + Intergenic
1154296979 18:13160273-13160295 CACAGTGAAGGAAGGGGATGAGG - Intergenic
1155646798 18:28088496-28088518 CAGAGTGAATTAACAGCACAAGG + Intronic
1156613941 18:38761201-38761223 GACAGAGAATGAAGAGGACAGGG - Intergenic
1158383515 18:56962687-56962709 CCCAGTGAATGAAGACAGTAGGG - Intronic
1158569385 18:58584181-58584203 TACAGTCAATGAAGAGAAAAGGG + Intronic
1159312716 18:66730566-66730588 CCCAGTGCAATAAGAGCATAAGG + Intergenic
1159810175 18:73009391-73009413 CATAGAGAATGTAGAGAATATGG + Intergenic
1160608363 18:80068956-80068978 CACAGTGAAAGAAAAGGAAAAGG + Intronic
1164217954 19:23167484-23167506 CACAGTGAATGATTAGCCTCTGG + Intergenic
1165244339 19:34489506-34489528 CACAAAGAATGAAGACCACATGG - Intronic
1166202935 19:41250278-41250300 CACAGGGAAGGAGAAGCATAGGG + Intronic
1167789862 19:51668080-51668102 CTCATTGAATGAAGATTATAAGG + Intergenic
928080454 2:28307954-28307976 CACTGTGAATGAAGTCCACAGGG - Intronic
929898844 2:45984346-45984368 AACAGTGAGTTAAGAGCATCAGG + Intronic
931653156 2:64486916-64486938 CCCAGTGCCTGCAGAGCATAAGG - Intergenic
932120130 2:69091142-69091164 CCCAGTGAAAGAAGAGAATTTGG - Intronic
932739414 2:74280340-74280362 CACTGTGAAAGCAGAGCATAGGG - Intronic
933704828 2:85281855-85281877 TATGGTGAATGAAGAGCAAAGGG + Intronic
933979468 2:87538562-87538584 CACAGTGAATCCTGAGCAGAGGG - Intergenic
935940578 2:108234001-108234023 CACAGTCAATGATAAGCAAATGG + Intergenic
936314355 2:111412229-111412251 CACAGTGAATCCTGAGCAGAGGG + Intergenic
939854149 2:147336985-147337007 AAATTTGAATGAAGAGCATATGG + Intergenic
940410638 2:153360136-153360158 CACAGAGAAGGAAGAGCAGTGGG + Intergenic
940467124 2:154045212-154045234 CACAATGAATGAACTGCTTAAGG + Intronic
941361481 2:164557207-164557229 CACACTAAATGGAGAGCAGAAGG + Intronic
942529459 2:176893709-176893731 CACATAGAATGAAGGGCTTACGG - Intergenic
944020204 2:195093867-195093889 AACAGTGAATTTAGAGAATATGG - Intergenic
944783149 2:203040617-203040639 CACAGTGATTGAGGAGCACCTGG + Intronic
945213643 2:207410421-207410443 CAAAGTGAATGACAAGCAAATGG + Intergenic
946126841 2:217570135-217570157 CTGAGTGAATGAGGAGGATAAGG + Intronic
1168860418 20:1042450-1042472 CACAGTGAGTGAGCAGAATAAGG - Intergenic
1169548061 20:6671230-6671252 CACAGTGGAAGAAGAACATGTGG + Intergenic
1169979304 20:11365449-11365471 CACAGGACATGAAGAGAATATGG - Intergenic
1171880248 20:30613340-30613362 GACAGTGAATGTAGAGCAGGTGG - Intergenic
1172092402 20:32443041-32443063 CACAGTGGAAGCAGAGCATTCGG + Exonic
1172364771 20:34340597-34340619 AACAGGGAATGATGAGCATAAGG - Intergenic
1173234484 20:41232216-41232238 CACAGAGAATGATGACCAGATGG + Intronic
1173538037 20:43830728-43830750 CACCTTGTAAGAAGAGCATATGG - Intergenic
1173783578 20:45775922-45775944 CACTATGAATCCAGAGCATAGGG - Intronic
1173993858 20:47323114-47323136 CAAAGTGAATGAAAGGCATCTGG + Intronic
1174716293 20:52762370-52762392 CACAGTGTATGAAATGCACAGGG + Intergenic
1174767598 20:53268626-53268648 AACAGTGAATGAACAACAAATGG + Intronic
1175639982 20:60620857-60620879 AACAGGGAAGGAAGAGCATACGG + Intergenic
1177502542 21:21976614-21976636 CACACTTGATGAAGAACATAGGG + Intergenic
1178483434 21:33000829-33000851 CACACTGAAGTTAGAGCATAAGG + Intergenic
1178954690 21:37011658-37011680 CACAGTGAATTATGAAAATATGG + Intronic
1179089864 21:38255229-38255251 CTCAGTGAATGAAGGCCAGAGGG + Intronic
1179299263 21:40091735-40091757 GAAGGTGAATGAGGAGCATAGGG + Intronic
1180092135 21:45538610-45538632 CACAGTGAGGGAAGGGCAGAGGG + Intronic
1181660524 22:24343879-24343901 GAAAGTGAATGAGGAGTATATGG + Intronic
1181990691 22:26834598-26834620 CAGAGTGAGTGAAGAGGAGATGG - Intergenic
1182552150 22:31106335-31106357 CACAGTGGAGGCAGAGCAGAAGG + Intronic
949200962 3:1378817-1378839 CACAGTGCATGAAGACAATTGGG - Intronic
949218138 3:1596434-1596456 CTCAGTGAATAAAAAGCATAAGG + Intergenic
950700905 3:14745299-14745321 CAGAGGGAAAGAGGAGCATAAGG - Intronic
950889584 3:16391635-16391657 CATAGTGGATGAAGAGCAGAGGG + Intronic
951261665 3:20517080-20517102 CCCAGTGACTGATGAGGATATGG - Intergenic
951781095 3:26363323-26363345 CACAATCAATGAACAGAATATGG - Intergenic
952004250 3:28823975-28823997 CAAAGTGAACGTAGAGCAAATGG - Intergenic
953152391 3:40336621-40336643 CACACTGTAAGAAGAGCATGTGG - Intergenic
953557964 3:43961898-43961920 GATTCTGAATGAAGAGCATATGG - Intergenic
954432132 3:50476384-50476406 CACAGTGCATGAGGAGCACCTGG - Intronic
955746658 3:62147342-62147364 CACAGTAAAGGATGTGCATAGGG - Intronic
955790374 3:62582903-62582925 CAGAGTGAATGAAGAGAATGTGG + Intronic
955929202 3:64038716-64038738 CAAAGTGAATTAATAGCATTTGG - Intergenic
956009203 3:64812655-64812677 CAGAGTGTATGAAGAAAATATGG - Intergenic
956254651 3:67271096-67271118 CACACTGTAAGAAGAGCATGTGG - Intergenic
957014747 3:75049851-75049873 CACTGTGAATAAAAAGAATAGGG + Intergenic
957667875 3:83258618-83258640 CACAGAGAAGGAATAGCACAAGG + Intergenic
959391251 3:105777105-105777127 CACAGTGAAAGCAGAGCAGAGGG + Intronic
960531469 3:118770315-118770337 CATTGTGAATCAAAAGCATATGG + Intergenic
961223351 3:125217575-125217597 CATATTGTAGGAAGAGCATATGG - Intergenic
961249911 3:125493061-125493083 TTCAGTGAAAGAAGAGCAAAGGG - Intronic
961625452 3:128259638-128259660 CACAGAGAATGAGGAGCAAAGGG - Intronic
961673927 3:128553597-128553619 GGAAGTGAATGAAGAGCAAAAGG + Intergenic
961864967 3:129947060-129947082 CACATTGCATGAAGAGTATGTGG - Intergenic
962168052 3:133071146-133071168 AACAGTGAGTAAAGAGTATATGG - Intronic
964059965 3:152509410-152509432 CAGAGTGAGTGAAGAGAATATGG + Intergenic
964144149 3:153438519-153438541 CACAGTTAATAAAGAGTATCAGG + Intergenic
965845490 3:172956235-172956257 ACCAGTGATTCAAGAGCATAAGG + Intronic
966678106 3:182611182-182611204 CACAGCGATTGAGGAGCATCTGG + Intergenic
970922911 4:21415869-21415891 CAGAGTGAATGAAGAGGAGATGG + Intronic
971490730 4:27209618-27209640 CCCAGTGAATGCAGAGCAGGTGG - Intergenic
974465667 4:62252222-62252244 CTCAGTAAATGAAGAAAATATGG - Intergenic
975504693 4:75124945-75124967 CACTCTGTAAGAAGAGCATATGG - Intergenic
975702788 4:77082605-77082627 CACAGTGATTGAGGAGCACCTGG - Intergenic
976346589 4:84010127-84010149 CCTAATGAATGAAGACCATAAGG - Intergenic
978160827 4:105545915-105545937 CACATTATAAGAAGAGCATATGG - Intergenic
978598049 4:110399981-110400003 CACAGTGATTGAGGAGCACCTGG - Intronic
978638487 4:110840511-110840533 CAAAATGAATGAAGAGCAAATGG + Intergenic
978854091 4:113373326-113373348 CACAGAGAAAGAAGAGATTATGG + Exonic
979028606 4:115609674-115609696 CACATTGAATGAAGATGATATGG + Intergenic
980538901 4:134166830-134166852 GTCAGTGAATGAAGGGCAGAGGG - Intergenic
981834327 4:149037923-149037945 CACTGGGAATGAACAACATAGGG - Intergenic
982864885 4:160498484-160498506 CCCAGTGACTGAATAGGATACGG + Intergenic
983508267 4:168579023-168579045 CACAGGAAAAGAAGAGCATTTGG + Intronic
984478625 4:180269821-180269843 CACAGAAAATGAAAAACATATGG + Intergenic
984642058 4:182177458-182177480 AACAGTGAATCAGGAGCATCAGG - Intronic
984883548 4:184430405-184430427 GCCAGGGAATGAAGAGCAGAGGG - Intronic
984974991 4:185222297-185222319 TACAGTGAACGAGGAGTATATGG - Intronic
985866027 5:2515281-2515303 CCCACTGAATGGAGAGAATACGG - Intergenic
986789667 5:11147461-11147483 CATGGTGAATGAAGAGCAGAGGG + Intronic
987034144 5:14003587-14003609 CACACTGAAGGATGAGCATGTGG - Intergenic
988269993 5:29001945-29001967 CACTGTGAATGAAGAACTTGAGG + Intergenic
991427957 5:66510909-66510931 CCCAGTGAATCATGAGAATAAGG + Intergenic
992031483 5:72725923-72725945 CACAGTGATTGAGGAGCACCTGG + Intergenic
992244222 5:74801890-74801912 CATAGTGAAGGGAGAGCATGTGG - Intronic
992386964 5:76293951-76293973 CACAGGGAAAGAAGAGAGTATGG - Intronic
993036750 5:82767558-82767580 CACAATCAAGGAAGAGCAGAGGG - Intergenic
995404627 5:111780822-111780844 CACATTGGAAAAAGAGCATATGG - Intronic
995677659 5:114681353-114681375 CACATTGTATGAAGACCATGGGG + Intergenic
996977908 5:129457303-129457325 ACCAGTGAGTGAAGAGAATAAGG + Intergenic
997846658 5:137292398-137292420 ACCAGTGAATGGACAGCATAGGG - Intronic
998219588 5:140265779-140265801 CACACTGAATGAATAGCATTGGG + Intronic
998577527 5:143333008-143333030 CACAGTGATTGAGGAGCACCTGG + Intronic
999065729 5:148683652-148683674 CACATTGAAAGAAGAGCACATGG - Intergenic
1000652538 5:163834664-163834686 CACAGTGACAGAAGAACATGAGG + Intergenic
1002312991 5:178325838-178325860 CACTGGGAATGGAGAGCATGTGG + Intronic
1003091554 6:3108152-3108174 CACAGTGAATAAAAAGCAGTGGG - Intronic
1004978815 6:20998934-20998956 CACAGTCAATGAAAAGAAAATGG + Intronic
1005649175 6:27870876-27870898 CACAGTCTATGACAAGCATATGG + Intergenic
1006816740 6:36856259-36856281 CACAGTTAGTGAGGAGCATCAGG - Intronic
1007476973 6:42125418-42125440 CACAGTGAGTGCTCAGCATACGG + Intronic
1007795193 6:44341495-44341517 CATACTGTATGAAGAGCACAGGG - Intronic
1010301801 6:74269376-74269398 CACATTGCAAGAAGAGCATGTGG - Intergenic
1013353529 6:109327384-109327406 CACAGTGATTGAGGAGCACCTGG - Intergenic
1015458529 6:133460219-133460241 AAAAGTGAATGAACAGCAGATGG + Intronic
1015815383 6:137205493-137205515 CACAGTGGCTGAAGAGAATAAGG + Intronic
1017316329 6:153035784-153035806 CACCCTGAAGGAGGAGCATATGG + Intronic
1017537750 6:155366565-155366587 CCCAGAGAATGAAGGGCAAAGGG - Intergenic
1017950828 6:159133271-159133293 CACTGTGAATGACGAGCGAAGGG - Intergenic
1018523306 6:164677911-164677933 CACAGGGCATGAAGAGAATATGG + Intergenic
1019884128 7:3889367-3889389 GACAGTGAATGAAGTGCAGGTGG + Intronic
1019961828 7:4466885-4466907 CACAGTGAATGAACAGGAATAGG + Intergenic
1020478243 7:8624712-8624734 CAGAGTGAATGAAAGGCATTTGG + Intronic
1022642425 7:32200840-32200862 CACATTGCAAGAAGAGCATGTGG + Intronic
1023621188 7:42074729-42074751 CACAGAGAATGGTGAGCTTATGG - Intronic
1024316467 7:48023257-48023279 CCCAGTGAATACAGATCATAAGG + Intronic
1026303000 7:69115290-69115312 CACAGTGACTGGAGTTCATAAGG - Intergenic
1027178825 7:75923213-75923235 CACAGTGATTGAGGAGCACCTGG + Intronic
1030542226 7:110845139-110845161 CACAGTGAATGAAGGTGAAAGGG - Intronic
1031806647 7:126315891-126315913 TACATTGAATGAAGTGCATATGG + Intergenic
1036021103 8:4847663-4847685 CATAGTCATTGAAGAGCTTAAGG - Intronic
1037913895 8:22760492-22760514 AACAGTGAATGAAGAGGCCATGG + Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038184710 8:25263066-25263088 CACAGAGAATGAAGAAAAAAAGG - Intronic
1038269174 8:26061418-26061440 CACTGGGAATGAAGACCATGGGG + Intergenic
1040019279 8:42725699-42725721 CACAGTGATTGAGGAGCACCTGG - Intronic
1041130708 8:54696907-54696929 CACAGTGATTGAGGAGCACCTGG + Intergenic
1041607753 8:59803654-59803676 GATACTGAATGAAGAGTATATGG - Intergenic
1042798446 8:72690131-72690153 CTCAGTGAATGCAGAAAATATGG - Intronic
1042857218 8:73279614-73279636 CACAGTGAAGGAAGAGCATGTGG - Intergenic
1044390257 8:91641601-91641623 TTAAGAGAATGAAGAGCATAAGG - Intergenic
1044806341 8:96012101-96012123 CAGAATGAATAAAGAGCATCTGG - Intergenic
1045529475 8:102970839-102970861 CTCAGTGAATGAAGAGAAACTGG - Intronic
1046031201 8:108785815-108785837 CACAGTGAATAAGCAGCATATGG - Intronic
1046985191 8:120380306-120380328 CACAGTGAATAGAGATAATAAGG + Intergenic
1048644633 8:136406237-136406259 CACAGATAATGAAGAGGAGATGG + Intergenic
1051564779 9:18485348-18485370 CACATAGAATAAAGAGAATAAGG - Intronic
1051746384 9:20298834-20298856 CAAAGGAAATGAAGAGCATAGGG - Intergenic
1052113228 9:24615950-24615972 CAGAGGGAATGAAAAGCATTGGG + Intergenic
1054859356 9:69933099-69933121 CACAGTGAAAGAAGGGTACAAGG - Intergenic
1056588118 9:87941712-87941734 CAGAGTGTATTAAGAACATAGGG + Intergenic
1056608748 9:88111231-88111253 CAGAGTGTATTAAGAACATAGGG - Intergenic
1059779606 9:117512625-117512647 CACATTGAATGAAGAGATGAAGG + Intergenic
1060772797 9:126345013-126345035 CACATTGAAAGCATAGCATATGG + Intronic
1186689706 X:11962322-11962344 CACAGAGCAGGAAGAGCAGAAGG + Intergenic
1187077501 X:15949652-15949674 TAGAATGAATGAAGAACATAAGG - Intergenic
1187126989 X:16463144-16463166 CACAGTGTCTGCAGAGCTTATGG - Intergenic
1187807815 X:23140306-23140328 CACATTGTAAGAAGAGCACATGG - Intergenic
1189696436 X:43668669-43668691 GACAGAGAAATAAGAGCATATGG - Intronic
1189912461 X:45824762-45824784 CCCAGGGAAGGAAGAGCCTAAGG + Intergenic
1189938585 X:46096920-46096942 CACAGGGACTCAATAGCATATGG - Intergenic
1189951530 X:46236275-46236297 GAAGGTGGATGAAGAGCATATGG - Intergenic
1190473527 X:50806264-50806286 CACAGTGAAAGAGGAGGATGTGG + Intronic
1190957876 X:55213927-55213949 CACTGTGAATGAGGAGCCTCTGG + Intronic
1192958761 X:76104003-76104025 CAAGGTGAATGAAGAGCTTTAGG - Intergenic
1193181679 X:78465855-78465877 CTCATTGATTGAAGGGCATATGG + Intergenic
1194766714 X:97850212-97850234 GATAATGAATGAAGAGCAAATGG + Intergenic
1197594926 X:128453226-128453248 CACAGTGAAATATGAACATAAGG + Intergenic
1199218336 X:145287188-145287210 CACAGTAAATGAAAAGAGTAAGG + Intergenic
1199497148 X:148465197-148465219 CACAGTGATTGAGGAGCACCTGG + Intergenic
1199730769 X:150629990-150630012 TACATGGAATGAAGATCATAGGG - Intronic
1200020075 X:153195932-153195954 CACATGGAAAGAAGAGCATGGGG + Intergenic
1200826600 Y:7651237-7651259 ACCAGAGAATGAAGAGCACAAGG - Intergenic