ID: 911618768

View in Genome Browser
Species Human (GRCh38)
Location 1:100042927-100042949
Sequence ATAAACACCCTGATGTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911618768_911618772 3 Left 911618768 1:100042927-100042949 CCTAGAAACATCAGGGTGTTTAT 0: 1
1: 0
2: 2
3: 16
4: 175
Right 911618772 1:100042953-100042975 GTCTTTGGCAGGTGTGTGGCTGG 0: 1
1: 0
2: 6
3: 21
4: 289
911618768_911618770 -8 Left 911618768 1:100042927-100042949 CCTAGAAACATCAGGGTGTTTAT 0: 1
1: 0
2: 2
3: 16
4: 175
Right 911618770 1:100042942-100042964 GTGTTTATATTGTCTTTGGCAGG 0: 1
1: 0
2: 2
3: 18
4: 261
911618768_911618771 -1 Left 911618768 1:100042927-100042949 CCTAGAAACATCAGGGTGTTTAT 0: 1
1: 0
2: 2
3: 16
4: 175
Right 911618771 1:100042949-100042971 TATTGTCTTTGGCAGGTGTGTGG 0: 1
1: 0
2: 0
3: 9
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911618768 Original CRISPR ATAAACACCCTGATGTTTCT AGG (reversed) Intronic
903422221 1:23226153-23226175 TTCAACCCCCTGATTTTTCTGGG - Intergenic
904320582 1:29695492-29695514 ATAAACTCCCTCATATTTCAGGG + Intergenic
904885131 1:33731913-33731935 ACAACCACCCTGCTGGTTCTGGG - Intronic
906463544 1:46056419-46056441 ATTAGCACCCTGATGTTCCCTGG + Intronic
908889340 1:68825850-68825872 ATATATAACCTGATGTTTCAGGG + Intergenic
909064188 1:70913794-70913816 TTAAACAACCTTATTTTTCTGGG + Intronic
911618768 1:100042927-100042949 ATAAACACCCTGATGTTTCTAGG - Intronic
911910325 1:103626813-103626835 AGAAAAACCATGAAGTTTCTAGG + Intergenic
911917743 1:103720938-103720960 AGAAAAACCATGAAGTTTCTAGG + Intronic
917722809 1:177802238-177802260 ATGAACTGCCTGGTGTTTCTGGG - Intergenic
920508851 1:206536071-206536093 ATCAAAACCCTGGTATTTCTGGG + Intronic
921766568 1:218979859-218979881 ACAAACTCCCTGATGTTGTTTGG + Intergenic
921914435 1:220591299-220591321 AGAAACATACTGATGTTTCCTGG - Intronic
1065414192 10:25466808-25466830 ACACACACCCTGGTGTTACTAGG + Intronic
1066270174 10:33814711-33814733 AAAAACACCCTTATGTATTTAGG + Intergenic
1068090251 10:52424731-52424753 AGAAACACCATGAGGTTTCGGGG - Intergenic
1069156746 10:65038954-65038976 ATAAACAGCCAGATGTTTTTTGG + Intergenic
1069679084 10:70270896-70270918 CTATACACCCTGATCTCTCTTGG - Intronic
1071469504 10:85972796-85972818 ATGAACACATTGATGATTCTAGG + Intronic
1073560666 10:104493778-104493800 AAAAAATGCCTGATGTTTCTGGG - Intergenic
1074554792 10:114478369-114478391 AGAAATGCCCTGATGTATCTTGG + Intronic
1077882036 11:6358633-6358655 ATAAACATTTTGGTGTTTCTGGG + Intergenic
1077935798 11:6784266-6784288 ACAAACATCCTGATCTTCCTAGG + Intergenic
1078703370 11:13712967-13712989 TTATACACCATGATGTTTCTTGG - Exonic
1078765387 11:14291899-14291921 ATATACATAATGATGTTTCTTGG + Intronic
1078900226 11:15635184-15635206 ATAATCACACTGATGTCTCAAGG + Intergenic
1087249490 11:95881223-95881245 AGAAACAGACTGATGTTTGTAGG - Intronic
1088046729 11:105461770-105461792 TTAAACACCCAGATTTTTTTAGG - Intergenic
1088399850 11:109411617-109411639 ATAAGCACCTTTATGATTCTTGG + Intergenic
1091088726 11:132749017-132749039 ATACACACTGTGATGTTTCTAGG + Intronic
1092697120 12:11185046-11185068 ATAAACATTTTGATGTTTCTAGG - Intergenic
1092754540 12:11751019-11751041 ACATACATCCTGAGGTTTCTTGG - Intronic
1093204842 12:16235698-16235720 GTACATACCATGATGTTTCTTGG + Intronic
1093371707 12:18374239-18374261 AAAAACATCCTGATTTTTCAAGG - Intronic
1093482409 12:19618424-19618446 ATATACACCCTGAAGTATTTAGG - Intronic
1098107435 12:67084124-67084146 ATCAGCAACCTGATCTTTCTTGG + Intergenic
1100181483 12:92091084-92091106 ATAAAGACCCTGATTTTTGGCGG + Intronic
1100539627 12:95545903-95545925 ATAATTACCCTGATCTTGCTTGG + Intronic
1100769946 12:97910643-97910665 ATAAACAGCATTATTTTTCTTGG + Intergenic
1101109531 12:101472432-101472454 ATTAAAACCCTGATATTTCTAGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101764433 12:107684991-107685013 ATCAAAACCCAGATTTTTCTGGG + Intergenic
1106436688 13:29729566-29729588 ACAGACTCCCTGATGTTTTTGGG + Intergenic
1106968355 13:35102444-35102466 ATAAAAATCCTCATGTTTTTTGG - Intronic
1107438373 13:40402327-40402349 ATAACCACTCTGGTGTGTCTTGG + Intergenic
1107727255 13:43311296-43311318 ATAAGGACCCTGAGGTCTCTTGG - Intronic
1109011587 13:56954895-56954917 ATAAATTCCCTAGTGTTTCTTGG - Intergenic
1109653715 13:65363234-65363256 ATAAACACATTAAAGTTTCTTGG - Intergenic
1109732411 13:66431824-66431846 ATAAAAACCCTAATGAATCTTGG - Intronic
1110505655 13:76283095-76283117 ATAAACACAATGAGGTCTCTTGG + Intergenic
1110793962 13:79615719-79615741 TTTAACACCCTCATTTTTCTTGG - Intergenic
1111385930 13:87527528-87527550 ATAAACAGACTGATTTTTGTGGG + Intergenic
1112345033 13:98582002-98582024 CTAAACAGCCTGATGTTCCCTGG - Intergenic
1112739481 13:102457002-102457024 ATAAAAGCCCTTATGTTTTTAGG - Intergenic
1113346672 13:109484837-109484859 AAAAACACTCTGATTTTACTGGG + Intergenic
1115485958 14:33911547-33911569 ATAAACAGCATGATGTTTGCAGG + Intergenic
1120917903 14:89726242-89726264 AAAAACACACTGATGGTTCATGG + Intergenic
1123213605 14:106785080-106785102 ATGAAAAGCCTGAGGTTTCTGGG - Intergenic
1123484624 15:20678126-20678148 ATAAAAATCCTCATGTTTTTTGG + Intergenic
1123537352 15:21247190-21247212 ATAAAAATCCTCATGTTTTTTGG + Intergenic
1125740124 15:41956950-41956972 ATAAACACCCTTATATATGTTGG + Intronic
1125780612 15:42263077-42263099 TTAAAAACCCTGATTTTTCTGGG + Intronic
1128693236 15:69741458-69741480 ATATACAACCTGATGGTTTTTGG - Intergenic
1128698525 15:69787424-69787446 AAAAAAACCCTGATCTTTCCTGG + Intergenic
1129638833 15:77352643-77352665 ATAAACAACCTTAGGTTTCTAGG - Intronic
1131212002 15:90505749-90505771 TGAAACACCCCAATGTTTCTCGG - Intergenic
1134427313 16:14163011-14163033 ATAAATACGTTGATGTTTTTGGG - Intronic
1135272284 16:21079762-21079784 ATAAAAACCCTTAGGTTTTTTGG - Intronic
1136955881 16:34785988-34786010 ATAAAGACACTTATGATTCTTGG + Intergenic
1139404928 16:66710737-66710759 ATAAAAAACCTGGGGTTTCTTGG - Intergenic
1141243699 16:82287052-82287074 CTAAAAACCCTGGTGTCTCTGGG - Intergenic
1143337887 17:6187152-6187174 GTAGAGAGCCTGATGTTTCTTGG - Intergenic
1147284325 17:39389294-39389316 AAAAGCAACCTGATGTATCTTGG - Intronic
1148123193 17:45224124-45224146 ATAAACACACTGGGGTTCCTGGG - Intronic
1149139510 17:53413707-53413729 CTAAACACTATTATGTTTCTTGG - Intergenic
1154094227 18:11395692-11395714 AAAGACTCACTGATGTTTCTTGG - Intergenic
1155187686 18:23401792-23401814 TCAAACACCCTGATGCCTCTTGG - Intronic
1156218274 18:35025123-35025145 ATAACCACTGTGAAGTTTCTTGG + Intronic
1158264606 18:55647998-55648020 ATACAGACTCTGATGTTTCAGGG + Intronic
1159016946 18:63108920-63108942 ATAAATACACCAATGTTTCTTGG - Intergenic
1159024679 18:63172350-63172372 CTAAACACCCTGATGCTGCTTGG + Intronic
1160137378 18:76283953-76283975 ATGAACACCCTGATGCTATTTGG + Intergenic
1162958075 19:14110923-14110945 TTCAACCCCCTGATGTTCCTGGG + Intronic
1166618942 19:44277822-44277844 ATAAACATACTGATGATGCTGGG + Intronic
1168231997 19:55038510-55038532 ATAAACTCCCTGATGTCACTAGG + Intergenic
925248842 2:2411481-2411503 AGGAGAACCCTGATGTTTCTAGG + Intergenic
928229476 2:29484381-29484403 ATAAACACACTGCTGGATCTGGG + Intronic
928633977 2:33223810-33223832 CTAAACACACTCATGTTTCTAGG - Intronic
930114728 2:47708865-47708887 ATAATCACCCAGATGTTATTAGG + Intronic
930685784 2:54306640-54306662 GTAACCACCCTGGTGTTTGTAGG - Intergenic
936040769 2:109147359-109147381 ATAAGCACCTTGTTGTTGCTGGG + Intronic
937009125 2:118545907-118545929 ATAATCAGCCTGATGGTTATAGG - Intergenic
937020090 2:118642410-118642432 CTAAATCCCTTGATGTTTCTGGG - Intergenic
938915262 2:135931979-135932001 ATGAAAAACCTGAGGTTTCTAGG + Intronic
943326781 2:186508806-186508828 ATAAACATCCTGTTGATTCTAGG - Exonic
943605069 2:189967368-189967390 AGTTACACCCTGATGTGTCTAGG - Intronic
943726865 2:191260597-191260619 AGAAGCACCCAGATTTTTCTGGG + Intronic
945115805 2:206406751-206406773 ATAAACACCCTGAGGTTACTAGG - Intergenic
1177199725 21:17940719-17940741 AGATACACCCTGATTTCTCTTGG - Intronic
1177498149 21:21915452-21915474 ATAAATACTCTGAAATTTCTTGG + Intergenic
1177618156 21:23552671-23552693 ATAAACACTATTATTTTTCTAGG - Intergenic
1181298379 22:21860870-21860892 AAATAGAGCCTGATGTTTCTTGG + Intronic
1182426587 22:30276451-30276473 ATAAACACCCTGAGTTTCCTTGG - Intergenic
1185417465 22:50718093-50718115 ATCAAAATCCTGATGTTTCAAGG - Intergenic
949850541 3:8416137-8416159 TCAGACACCCTGATGCTTCTTGG - Intergenic
953125725 3:40090170-40090192 ACAAAATCCCTGATCTTTCTGGG + Intronic
955973711 3:64461221-64461243 AAAATCAGCCTGATGTTTCATGG + Intergenic
956892698 3:73627711-73627733 ATAAACACTCAGATGTTTCTGGG - Intergenic
959703983 3:109323266-109323288 ATAAACCCCCTGATGTATTGTGG + Intergenic
960409102 3:117300149-117300171 ATAAACACCCATATATTTCAGGG - Intergenic
960506178 3:118497448-118497470 ATTATCACACTGATGTTTCATGG - Intergenic
963237427 3:142969449-142969471 AAAAACACCCTGTTGCATCTTGG + Intronic
963811440 3:149780708-149780730 ATCAACACTCTTATGTATCTGGG - Intronic
964084007 3:152794413-152794435 TTAAACACCATGTTCTTTCTTGG - Intergenic
964157815 3:153606877-153606899 AGACAAACCCTGATGTTCCTGGG - Intergenic
964487811 3:157203936-157203958 ATATACACACTCATTTTTCTAGG + Intergenic
965041333 3:163510928-163510950 ATAAACACACTGATGTATAGTGG - Intergenic
965259150 3:166457793-166457815 ATAAACAACCTTAGATTTCTGGG - Intergenic
965366816 3:167811162-167811184 ATAAAAACACTGATGTTTCATGG - Intronic
966472214 3:180303466-180303488 ATAAATCTCCTGTTGTTTCTTGG - Intergenic
966553492 3:181231210-181231232 ATGATCACCATCATGTTTCTAGG + Intergenic
966568800 3:181416168-181416190 TTAAACACACTGAGATTTCTTGG - Intergenic
967712229 3:192722581-192722603 GGAATCACACTGATGTTTCTGGG + Intronic
968324696 3:197803443-197803465 ACAAGCACCCTGATGGTACTAGG + Intronic
972990555 4:44818454-44818476 ATAAACACCTAGAGGTTTTTGGG + Intergenic
973160789 4:47013474-47013496 ATGAACAAAATGATGTTTCTTGG + Intronic
973214419 4:47653697-47653719 ATAAATTAGCTGATGTTTCTGGG - Intronic
974426996 4:61754589-61754611 ATATACACTCAGATCTTTCTAGG - Intronic
977360504 4:95998574-95998596 ATAAACACCTTGGTGTTTCCTGG - Intergenic
977748145 4:100576363-100576385 AAAATCACCATGATGTGTCTTGG + Intronic
980606511 4:135098424-135098446 ATCAACACAATGATGTTACTGGG - Intergenic
984557842 4:181236736-181236758 ATAAAGACACTGATGTTCATAGG - Intergenic
986986782 5:13509230-13509252 AAATGCACCCTGAAGTTTCTTGG - Intergenic
987012498 5:13781839-13781861 ATAAACACCCTCCTATTACTTGG + Intronic
987242135 5:16010968-16010990 ATAAACACTCTCTTGTTTTTTGG - Intergenic
988586113 5:32508955-32508977 ATAAATACCCGTATGTTTCCAGG + Intergenic
990234004 5:53746506-53746528 ACAAACACCCAGAATTTTCTGGG - Intergenic
992578120 5:78140743-78140765 AGAAACAGCTTGGTGTTTCTGGG - Intronic
993024353 5:82628597-82628619 AAAAACAGCCTTATTTTTCTTGG + Intergenic
993759619 5:91776995-91777017 ATAAACACACAGATATTTTTGGG - Intergenic
993935219 5:93991267-93991289 ATAAGCAGCCTGATCATTCTAGG - Intronic
994732387 5:103507922-103507944 AGAAACACCCTGGTGGTCCTGGG - Intergenic
995251566 5:109999140-109999162 ATAGACCCTCTGCTGTTTCTGGG - Intergenic
997589829 5:135065823-135065845 ATTTACACCCTGTTGGTTCTAGG + Intronic
998608305 5:143660041-143660063 ACAAAAGCCCTGATGTTGCTGGG + Intergenic
999971543 5:156868882-156868904 ATAAACACCCTGATATGGTTTGG + Intergenic
1000441678 5:161271137-161271159 TTAAACACACAGAGGTTTCTGGG + Intergenic
1000735095 5:164889481-164889503 ATAAACAACATGATATTTTTAGG - Intergenic
1000924582 5:167178303-167178325 ATAAACACCCTGAAGTCTGAGGG - Intergenic
1001367404 5:171157147-171157169 CTAAAAACCCAGATATTTCTTGG - Intronic
1001477789 5:172063381-172063403 AGAGACACCCTGTTGTTTATTGG - Intronic
1001561587 5:172673196-172673218 ACAAATACCCTGCTGTTTCCAGG + Intronic
1002572875 5:180153988-180154010 ATAAACATCCTGGGGCTTCTGGG - Intronic
1002865948 6:1122468-1122490 ACAGGCACTCTGATGTTTCTGGG - Intergenic
1004093207 6:12526470-12526492 ATATACACCCTGAAGTATTTAGG - Intergenic
1004641739 6:17522402-17522424 ATAAAAACCCTGCTGCTTCACGG - Intronic
1009651582 6:66482919-66482941 ATAAACACCCTCATCTTGCCAGG - Intergenic
1013561766 6:111312433-111312455 ATAATAACCCTGATATTTTTTGG - Intronic
1017676340 6:156817880-156817902 AAATACACCCTGAAGTATCTAGG - Intronic
1022341345 7:29471472-29471494 ATAAATAACCTGATGCTTCCTGG - Intronic
1023885161 7:44349055-44349077 GTGAACACCCTTATGTCTCTGGG - Intergenic
1028336474 7:89663261-89663283 CTATAAAACCTGATGTTTCTTGG - Intergenic
1028474409 7:91238023-91238045 ATGTACAACCTGATATTTCTCGG + Intergenic
1030295134 7:107917407-107917429 ACACACACCCTGAAGTTGCTTGG + Exonic
1032651558 7:133884288-133884310 ATAAACTGCATGATGTTTGTAGG - Intronic
1034457059 7:151176280-151176302 GTAGAAACGCTGATGTTTCTGGG + Exonic
1037186797 8:16074336-16074358 ATAAACATTCTGTTGTTTCTAGG - Intergenic
1038385499 8:27140612-27140634 ATAAAGACCCTGTGGTTCCTGGG + Intergenic
1039750751 8:40476083-40476105 TTAAACAAGTTGATGTTTCTTGG + Intergenic
1040614044 8:49017371-49017393 ATAAATAACCTGATGGATCTGGG - Intergenic
1041417212 8:57623955-57623977 ATAAACACACAGATGTTTGGTGG + Intergenic
1042177114 8:66047822-66047844 ATAAAAACCCTGTTGTTGCCAGG + Intronic
1042783263 8:72516792-72516814 ATAAATTCCCAGAAGTTTCTAGG + Intergenic
1046320567 8:112568764-112568786 ATAAACACCCAAGAGTTTCTGGG + Intronic
1046584805 8:116138188-116138210 AAAAAAACCCTAATCTTTCTTGG - Intergenic
1046848704 8:118948731-118948753 ATGAATACTCTGAAGTTTCTAGG - Intronic
1047242440 8:123103885-123103907 ATAAAGACACTGATGGTACTGGG - Intronic
1048016336 8:130500773-130500795 ATAAACACCAAGCTGCTTCTTGG - Intergenic
1051117838 9:13717400-13717422 CTAAATACCCTCAGGTTTCTTGG + Intergenic
1052453846 9:28668139-28668161 ATAAAGACCTTTATTTTTCTTGG + Intronic
1052923556 9:33993275-33993297 ATAAACACTGTGATGTTGCTAGG - Intronic
1053151214 9:35744412-35744434 CTAACCACCCTGATTTCTCTAGG - Exonic
1053166837 9:35850791-35850813 AGAAATACCCAGAAGTTTCTGGG - Intronic
1054878516 9:70121414-70121436 ACAAAGAGCCTGAGGTTTCTAGG - Intronic
1055219945 9:73917310-73917332 AGAAAGACCTTGATATTTCTTGG - Intergenic
1059580756 9:115546057-115546079 ATGAACATCCTGATGGGTCTAGG - Intergenic
1060424615 9:123493951-123493973 AAAAAGACTCTGAGGTTTCTGGG + Intronic
1186970024 X:14831981-14832003 TGAAACACCATGATGTTTCCAGG - Intergenic
1192432123 X:71119410-71119432 ATAACCAGCCTGCTGTCTCTGGG + Exonic
1195391483 X:104366825-104366847 AGAAACAGCCTGAGGTTTCCAGG - Intergenic
1195777689 X:108425858-108425880 ATAAATACATTGATATTTCTGGG + Intronic
1198079896 X:133229611-133229633 ATAAACACCTTTATGTATATTGG - Intergenic
1201281994 Y:12350292-12350314 ATAAACACACTGAGCTGTCTTGG - Intergenic
1201576497 Y:15466676-15466698 ATAAAGTCTCTGTTGTTTCTGGG - Intergenic