ID: 911622604

View in Genome Browser
Species Human (GRCh38)
Location 1:100082339-100082361
Sequence CCGTGGGAACTAAAGGAAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911622598_911622604 24 Left 911622598 1:100082292-100082314 CCACAGTGTACTTTAAGATTGTC 0: 1
1: 0
2: 1
3: 3
4: 124
Right 911622604 1:100082339-100082361 CCGTGGGAACTAAAGGAAGTGGG 0: 1
1: 0
2: 1
3: 12
4: 111
911622597_911622604 28 Left 911622597 1:100082288-100082310 CCATCCACAGTGTACTTTAAGAT 0: 1
1: 0
2: 0
3: 9
4: 147
Right 911622604 1:100082339-100082361 CCGTGGGAACTAAAGGAAGTGGG 0: 1
1: 0
2: 1
3: 12
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911622604 Original CRISPR CCGTGGGAACTAAAGGAAGT GGG Exonic
901453711 1:9351730-9351752 AGGTGTGAACAAAAGGAAGTTGG + Intronic
905503685 1:38459520-38459542 CAGTGGCCACCAAAGGAAGTTGG - Intergenic
905935596 1:41821667-41821689 GCCTGGGAACTAAGGGAAGTAGG - Intronic
910666677 1:89732722-89732744 CACTGGGAAATACAGGAAGTGGG + Intronic
911622604 1:100082339-100082361 CCGTGGGAACTAAAGGAAGTGGG + Exonic
913513094 1:119580479-119580501 CCATAGGAACCAAAGGAAGGTGG + Intergenic
915808649 1:158881741-158881763 TCTTGGAAAATAAAGGAAGTGGG + Intergenic
916250738 1:162735365-162735387 GCTTGAGAACTAGAGGAAGTAGG - Intronic
916725948 1:167524551-167524573 CCTTGGGAAGCAAAGGAAGACGG - Intergenic
924272093 1:242344493-242344515 ACGTGGGAGGAAAAGGAAGTAGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1065480087 10:26184083-26184105 CCGTCGGTGCTAAAGGAAGGAGG + Intronic
1066486184 10:35847262-35847284 CCTGGGGAAATAAAGTAAGTAGG - Intergenic
1066712574 10:38251645-38251667 ACGTGGGAGGAAAAGGAAGTAGG - Intergenic
1077147689 11:1053300-1053322 CTGTGGGAACTGCAGGAAGGAGG - Intergenic
1077887307 11:6395473-6395495 CCCAGGGAACTAAAGGGTGTGGG - Exonic
1079205296 11:18409727-18409749 CCTTGGGAACTAAATTAAGCAGG + Intergenic
1080408157 11:31998414-31998436 TGCTGGGAACTAAAGGATGTGGG + Intronic
1081666002 11:44917498-44917520 CCATGGGAACCAGAGGCAGTGGG + Intronic
1085214647 11:74818175-74818197 CCCTGGGAAGGAAAGGAAGAGGG + Intronic
1085738634 11:79060984-79061006 CAGTGGGAACTAGAGAAAGATGG + Intronic
1088455602 11:110030034-110030056 CCTTGTGAACAAAAGGAAATGGG + Intergenic
1088967499 11:114738467-114738489 CCTTGGGACCTAAAGCAATTGGG + Intergenic
1094743066 12:33311501-33311523 CCATGGGAACTTAAGGAAGATGG + Intergenic
1095421525 12:42029041-42029063 CCCTGGGAAAAAAAGGAAGATGG - Intergenic
1096982962 12:55738784-55738806 CTGAGGGAACTCAAGGAAATAGG + Intergenic
1101287877 12:103334747-103334769 CCGTGGAAGCAAAGGGAAGTTGG - Intronic
1107131331 13:36899545-36899567 CAGGAGGAACTAAATGAAGTCGG + Intronic
1107343043 13:39430434-39430456 CTGTGAGGAGTAAAGGAAGTAGG - Intronic
1110436849 13:75485185-75485207 CAGTGGGAAGAAAAGGCAGTTGG - Intergenic
1111995497 13:95162209-95162231 ATGTGGAAACTAAAGGAAGAAGG - Intronic
1112526024 13:100148046-100148068 CCGTGGGGACTACAGGAACTGGG + Intronic
1112875406 13:104032315-104032337 CTTTTGGAACTATAGGAAGTTGG - Intergenic
1113567526 13:111327660-111327682 CCGTGGGAGGTAAAGGAAGCAGG - Intronic
1119723846 14:76909891-76909913 CCATGGAAACTAAAGGGAGTTGG - Intergenic
1121436679 14:93925218-93925240 CCGTGGGATCTCAAGGAAGCTGG + Exonic
1124986399 15:34620356-34620378 CCAGGGGAAGTAGAGGAAGTGGG - Intergenic
1126663624 15:51055845-51055867 TGGTGGGAACTACAGGCAGTTGG - Intergenic
1128282905 15:66411427-66411449 CCTTTGGAAGAAAAGGAAGTAGG + Intronic
1137832048 16:51553243-51553265 CTGTGGGAATTAATGGAATTTGG + Intergenic
1141088266 16:81112047-81112069 CCCTGGGAACTCAAGGAAGGTGG - Intergenic
1142043890 16:87912941-87912963 CGGTGGTGGCTAAAGGAAGTGGG + Intronic
1149548249 17:57520320-57520342 CCATGGGAACTGAAAGATGTGGG - Intronic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1152780643 17:82226150-82226172 AACTGGGAACAAAAGGAAGTTGG + Intergenic
1160563671 18:79773928-79773950 TCGTGGGGCCCAAAGGAAGTGGG + Intergenic
1162187941 19:8921861-8921883 CCCTGGGAAGGAAAGGAAGCTGG + Intronic
925252178 2:2448955-2448977 TCGTGGGAACTAATGGAGGGGGG + Intergenic
927493652 2:23537623-23537645 CTGCAGGGACTAAAGGAAGTAGG + Intronic
927702101 2:25275362-25275384 CTGTGGGAAGGAGAGGAAGTGGG - Intronic
929080241 2:38115379-38115401 ACATGGTAACTAAATGAAGTGGG - Intergenic
929462805 2:42116221-42116243 ACTTGGGAACTAAAGGAGTTTGG - Intergenic
930398200 2:50848867-50848889 CCCTGGGATTTATAGGAAGTGGG + Intronic
931221304 2:60290613-60290635 GAGGGGGAACTAAAGGAAGGTGG + Intergenic
932836998 2:75047161-75047183 CCAGGGGACCTAAAGGAATTTGG - Exonic
932880700 2:75499328-75499350 CCGAGTGAAATAATGGAAGTGGG + Intronic
934521452 2:95022645-95022667 CTCTGGGAACACAAGGAAGTGGG - Intergenic
934694381 2:96388612-96388634 CCCTAGGAGCTACAGGAAGTAGG + Intergenic
935038010 2:99397786-99397808 CAGTGGGTACTAAAGGCACTGGG - Intronic
935563079 2:104578371-104578393 CCATGGGCCCTACAGGAAGTAGG + Intergenic
936996449 2:118419337-118419359 CACTGGGGACTAAAGAAAGTTGG - Intergenic
937782382 2:125853898-125853920 TTGAGGGAACTAAAGAAAGTAGG - Intergenic
941258934 2:163271991-163272013 CCATGGCAACCAGAGGAAGTTGG - Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1173133765 20:40420955-40420977 AGGTGGGAATTCAAGGAAGTAGG + Intergenic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1174383202 20:50170905-50170927 CAGAGGGAACGAAAGGAAGAGGG + Intergenic
1175371027 20:58492011-58492033 CCGTGGAAAGGAAAAGAAGTCGG + Intronic
1177284594 21:19033281-19033303 CAGTGGGAAGTCAAAGAAGTGGG + Intergenic
1177665707 21:24155929-24155951 CCTTGGAAACTAAAGGAATTAGG - Intergenic
1177808398 21:25898811-25898833 CCCTGGGAGCCAAAGGAATTGGG - Intronic
1180749140 22:18111984-18112006 CCCTGGGAACTGAAAGAACTTGG + Intronic
1180903793 22:19394312-19394334 CCCAGGGAACTAAAGGGAGATGG - Intronic
949351708 3:3129932-3129954 CCATGAGAACTGAAGGAAGAAGG + Intronic
951615820 3:24542517-24542539 CAGAGGGAAGTAAAGAAAGTAGG + Intergenic
951790991 3:26484649-26484671 CAGTGGGAACCAAAGGTAGGTGG + Intergenic
953690596 3:45114711-45114733 CCATGAGAACTAATGAAAGTTGG - Intronic
954918952 3:54173009-54173031 TCCTGGGCACTAAAGGAACTGGG + Intronic
964427795 3:156571406-156571428 CTGTGTGGACCAAAGGAAGTAGG + Intergenic
964675930 3:159279800-159279822 AAAAGGGAACTAAAGGAAGTTGG + Intronic
966073893 3:175912169-175912191 CCTTGGGAACTAAAGTATTTTGG - Intergenic
967365916 3:188686365-188686387 CTGTGGGGACTAACTGAAGTGGG - Intronic
968286083 3:197509733-197509755 GCCTGGGAACTAGAGGAAGGAGG - Intergenic
968910023 4:3472899-3472921 ACCTGGGAACTAAAGGAACCAGG + Intronic
969313562 4:6368327-6368349 CCGTGGGTGCTACAGGGAGTCGG - Intronic
975692324 4:76978269-76978291 ACGTGGGAGCTACGGGAAGTGGG - Intronic
980367463 4:131823107-131823129 CCGTGGGAAATATTGGAATTGGG - Intergenic
981364792 4:143889876-143889898 CTGTGTGAACTTAAGCAAGTCGG - Intronic
981528599 4:145732150-145732172 ATGTGGGAACTAAAGGAATTAGG + Intronic
982637430 4:157914733-157914755 TTGTGGGAATTAAATGAAGTAGG - Intergenic
983998191 4:174211348-174211370 CAGTGGGAACTAAAGGACATGGG + Intergenic
987122405 5:14779363-14779385 GGGTGGGAACTAGAGGACGTTGG - Intronic
987642918 5:20634370-20634392 GCATGGGAACTAATGGAAGTCGG - Intergenic
992968640 5:82031478-82031500 CAGTGGGAATTAAACAAAGTAGG + Intronic
994552014 5:101246764-101246786 CCTTGGGAACTAGACTAAGTTGG + Intergenic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1003354569 6:5355118-5355140 AGGTGGGAGCTACAGGAAGTAGG - Intronic
1006174311 6:32112728-32112750 GTGTGGGAAGTAAAGGGAGTGGG + Intronic
1008551396 6:52635531-52635553 GACTGGGCACTAAAGGAAGTGGG - Intergenic
1016766793 6:147803901-147803923 CCATGGGAACCAAAGGATGGAGG - Intergenic
1017636565 6:156449739-156449761 ACATGGGAACTAAAGGAAGTAGG + Intergenic
1017964990 6:159256394-159256416 ATGTGGGAACTACAGGAAGGAGG - Intronic
1018923958 6:168193979-168194001 CCGTGGGGACTGAAGGAAAATGG - Intergenic
1019146511 6:169978670-169978692 CCGCGGGAACGAAGGGAAGGCGG + Intergenic
1019257998 7:63883-63905 CCGTGGGAACTGCAGGAACCAGG + Intergenic
1027852954 7:83472559-83472581 CCGAGGGAACTTAAGAAAGGAGG - Intronic
1034535216 7:151721824-151721846 CCATGGGAACTAAGGGACCTGGG - Intronic
1034826834 7:154272993-154273015 CAGTGGGAACAAAATGAAATGGG - Intronic
1034952981 7:155313488-155313510 CCCTGGGCACTAAAGAAAATAGG - Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035517968 8:252671-252693 CCTTGGCAACTATAGAAAGTGGG - Intergenic
1037929722 8:22871339-22871361 CCATGGGCACTAAAGGACCTAGG + Intronic
1038157472 8:25003642-25003664 CCTAGGGAACAAAAGGGAGTGGG + Intergenic
1041979778 8:63844369-63844391 CAGTGGGAGGTAGAGGAAGTGGG - Intergenic
1042467619 8:69146037-69146059 TTGTGGTGACTAAAGGAAGTGGG + Intergenic
1047499149 8:125429299-125429321 CGGTGGGAAACAAAGGATGTGGG - Intergenic
1048008408 8:130437769-130437791 CCGTGGGCACAACAGGAAGAAGG - Intronic
1049501508 8:142970222-142970244 AAGTGGTAACAAAAGGAAGTGGG + Intergenic
1057180101 9:93025154-93025176 CCAGGGGAAGTAAAGGGAGTGGG - Intronic
1061788347 9:133044489-133044511 CCATGGGGAGCAAAGGAAGTAGG - Intronic
1186336513 X:8595483-8595505 AAGTGGGAGCTAAAGGAAGATGG + Intronic
1186341306 X:8649123-8649145 CTCTGGGCACTAAAGGAATTTGG - Intronic
1187289395 X:17938490-17938512 CAGTGAGAATTAAAAGAAGTAGG - Intergenic
1190844661 X:54181378-54181400 GCTTGGGAAGTAAAGGAGGTGGG - Intronic
1196107618 X:111913410-111913432 TCCTGGGACCTACAGGAAGTTGG - Intronic