ID: 911624941

View in Genome Browser
Species Human (GRCh38)
Location 1:100112988-100113010
Sequence CACTTTCTGATAGGATTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1057
Summary {0: 1, 1: 2, 2: 63, 3: 295, 4: 696}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911624941_911624943 15 Left 911624941 1:100112988-100113010 CCTAACAATCCTATCAGAAAGTG 0: 1
1: 2
2: 63
3: 295
4: 696
Right 911624943 1:100113026-100113048 AACAAATCCTTCAGTCACTCTGG 0: 1
1: 0
2: 0
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911624941 Original CRISPR CACTTTCTGATAGGATTGTT AGG (reversed) Intronic
900815518 1:4840742-4840764 CACCTTCTGCCAGGATTGTGAGG - Intergenic
903005876 1:20298437-20298459 GACTTCCTGATAGGCTTGTAAGG - Intronic
903691303 1:25175488-25175510 CACCTTCTCATAGGACTGTGAGG + Intergenic
904980088 1:34492688-34492710 CTCTTTCTAATAGGATCGTGAGG + Intergenic
904981357 1:34505254-34505276 CACTTTTTAATAGGGTTATTTGG + Intergenic
905989882 1:42327287-42327309 CTCTTTCTGCTAGGATAGTTGGG - Intronic
906094746 1:43214953-43214975 TACTTTCTGATTGGATTGTTTGG + Intronic
906810402 1:48820913-48820935 CACTTTTTAATGGGATTGTTTGG - Intronic
906957778 1:50389887-50389909 CACTTTTTAATGGGGTTGTTTGG + Intergenic
907779841 1:57556610-57556632 CACTTTTTAATGAGATTGTTTGG + Intronic
907942951 1:59106737-59106759 CACTTTCTGATTGGGTGGGTTGG - Intergenic
907960090 1:59270972-59270994 CACTTTTTAATAGGGTTGTTTGG + Intergenic
908072010 1:60471328-60471350 CACCTTCTGCTATGATTGTGAGG - Intergenic
908881878 1:68742095-68742117 CACTTTCTGCCATGATTGTGAGG + Intergenic
909405469 1:75283328-75283350 CACTTTTTGATCAGATTCTTTGG + Intronic
909431919 1:75598164-75598186 CTTTTTCTCATATGATTGTTGGG - Intronic
909678271 1:78262476-78262498 CACTTTTTAATGGGGTTGTTTGG - Intergenic
909703944 1:78558604-78558626 CACTTTTTAATGGGGTTGTTTGG - Intergenic
909749787 1:79144617-79144639 CACTTTTTAATGGGGTTGTTTGG - Intergenic
910176982 1:84441384-84441406 CACTTTTTGATGGGGTTGTTTGG + Intergenic
910815209 1:91285109-91285131 CACTTTCTGCCATGATTGTGAGG + Intronic
910929770 1:92431595-92431617 CACTTTTTGATGGGGTTGTTTGG + Intergenic
911241382 1:95471105-95471127 CACCTGCTGAAAGAATTGTTGGG - Intergenic
911322688 1:96434269-96434291 CACTTTTTGATTGGGTTGTTTGG + Intergenic
911394691 1:97290997-97291019 CACTTTTTGATGGGGTTGTTTGG - Intronic
911442932 1:97951704-97951726 ACTTATCTGATAGGATTGTTAGG - Intergenic
911537059 1:99112996-99113018 CACTTTTTGATGGAGTTGTTTGG + Intergenic
911624941 1:100112988-100113010 CACTTTCTGATAGGATTGTTAGG - Intronic
911691563 1:100840455-100840477 CACTTTTTGATGGGGTTGTTTGG + Intergenic
911718202 1:101159794-101159816 CTCTTTTTGATACGGTTGTTTGG + Intergenic
911724778 1:101231873-101231895 CACTTTTTGATAGGGTTGTTTGG - Intergenic
912140212 1:106715548-106715570 CACTTTTCAATAGGGTTGTTTGG + Intergenic
912768335 1:112437461-112437483 CACTTTTTAATAGAATTGCTTGG + Intronic
913363620 1:118010885-118010907 CACTTTTTAATGGGGTTGTTTGG - Intronic
914348304 1:146818384-146818406 CACTTTTTGATGGGATTATCTGG + Intergenic
914399822 1:147307957-147307979 CACTTTTTGATGGGGTTGTTTGG - Intergenic
915037160 1:152937722-152937744 CACTTTTTGATGGGGTTGTTTGG + Intergenic
915039484 1:152956404-152956426 CACTTTTTGATGGGGTTGTTTGG + Intergenic
915060737 1:153182246-153182268 CACTTTTTAACAGGATTGTTTGG + Intergenic
915778071 1:158513207-158513229 CACTTTTTGATGGGGTTGTTTGG - Intergenic
915800436 1:158786154-158786176 AAATTTTTGATAGGATTATTTGG - Intergenic
915851579 1:159329859-159329881 CACTTTTTAATGGGGTTGTTTGG - Intergenic
916245134 1:162679965-162679987 CACTTTTTAATGGGGTTGTTTGG + Intronic
916263976 1:162871160-162871182 CAATTTTTGATGGGTTTGTTTGG - Intergenic
916449207 1:164903652-164903674 CACTTTCTACTATGATTGTGAGG + Intergenic
917184860 1:172341914-172341936 TACTTTTTAATGGGATTGTTTGG - Intronic
918489393 1:185064620-185064642 CAATTTTTGATAGGTTTATTGGG + Intronic
918727907 1:187948615-187948637 CACTTTCTGCCATGATTGTGAGG + Intergenic
919838579 1:201593269-201593291 CACTTGCTGACAGGCTTGTGGGG - Intergenic
920756080 1:208734569-208734591 CAATTTGTAATAGGGTTGTTGGG + Intergenic
921109753 1:212023578-212023600 CACTTTTTAATAGGGTTATTTGG + Intronic
921116085 1:212093074-212093096 CACTTTTTGATGGGATTATTTGG + Intronic
921479878 1:215651952-215651974 CCCTTGCTGATAGGATTGCCAGG + Intronic
921676717 1:217984219-217984241 CACTTTCTGCCATGATTGTGAGG - Intergenic
921976797 1:221211719-221211741 CACTTTTTGATGGAGTTGTTTGG - Intergenic
922331152 1:224577369-224577391 CACTTTTTGATGGGATTATTTGG - Intronic
923191460 1:231624734-231624756 CACTTTTTAATGGGGTTGTTTGG - Intronic
923278759 1:232421117-232421139 CACTGTCTGAAAGCATTTTTTGG + Intronic
923320478 1:232827674-232827696 CACTTTTTGATGGGACTGTTTGG + Intergenic
923374311 1:233344892-233344914 CACTTTTTGATGGGGTTGTTTGG - Intronic
923932721 1:238721147-238721169 CACCTTCTGCTATGATTGTGAGG + Intergenic
924008461 1:239638593-239638615 CACTTTTTGATGGGGTTGTTTGG + Intronic
924178756 1:241419879-241419901 CACTTTCTGCCATGATTGTGAGG + Intergenic
1064170542 10:13028314-13028336 CACCTTCTGACATGATTGTGAGG + Intronic
1064367593 10:14721676-14721698 CACTTTTTGTTGGGGTTGTTTGG + Intronic
1064496406 10:15915142-15915164 CACCTTCTGCCATGATTGTTAGG + Intergenic
1064775239 10:18769773-18769795 CACTTTCTGCCATGATTGTGAGG - Intergenic
1064842543 10:19611145-19611167 CACTTTCTTATAGGACTGCTAGG - Intronic
1064847984 10:19677496-19677518 CACTTTTTAATGGGGTTGTTTGG + Intronic
1066037163 10:31503894-31503916 CACTTTTCAATAGGATTATTTGG + Intronic
1066078305 10:31903772-31903794 CATTTTCGAATTGGATTGTTTGG - Intronic
1066153044 10:32644778-32644800 CACCTTCTGACATGATTGTAAGG + Intronic
1066410927 10:35168427-35168449 CACTTTTTGATGGGGTGGTTTGG + Intronic
1066799338 10:39167047-39167069 CACTTTCTGATGGGGTTGTTTGG - Intergenic
1067244264 10:44523656-44523678 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1068011481 10:51456748-51456770 CACTTTTTGATAGGATTATTTGG - Intronic
1068432842 10:56954840-56954862 CACTTTTTAATAAGATTATTTGG + Intergenic
1069195711 10:65548685-65548707 CACTTTTTAACAGGGTTGTTTGG - Intergenic
1069243352 10:66169852-66169874 CACTTTTTGATGGGATTGTTTGG + Intronic
1069586638 10:69609129-69609151 CATTTTCTAATTGAATTGTTTGG - Intergenic
1070413692 10:76169178-76169200 CTGTTGCTGATAGGATTCTTCGG + Intronic
1070857834 10:79621587-79621609 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1070870418 10:79746424-79746446 AGCTTTCTTGTAGGATTGTTGGG + Intergenic
1071016609 10:81004917-81004939 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1071045573 10:81371871-81371893 CACTTTCTGATAGAATTGTTTGG + Intergenic
1071637336 10:87268641-87268663 AGCTTTCTTGTAGGATTGTTGGG + Intergenic
1071657910 10:87469310-87469332 AGCTTTCTTGTAGGATTGTTGGG - Intergenic
1071882519 10:89914897-89914919 CAATTTCTGATAGGAATCTGGGG - Intergenic
1071929755 10:90455308-90455330 CATTTTTTAATGGGATTGTTTGG + Intergenic
1071957243 10:90771883-90771905 CATTTTGTTATAGGATTTTTGGG - Intronic
1072396555 10:95049127-95049149 CACTTTCTAATGGGATTATTCGG - Intronic
1072397446 10:95059472-95059494 CACTTGTTGATGGGGTTGTTTGG + Intronic
1072561014 10:96574234-96574256 CACTTTTTGATGGGGTTGTTTGG - Intronic
1073525151 10:104174313-104174335 CACTTTCTGCCATGATTGTGAGG - Intronic
1073678507 10:105677158-105677180 CACTTTGTAATTGGGTTGTTTGG + Intergenic
1073713209 10:106069634-106069656 CACTTTTTAATAGGACTGTTTGG + Intergenic
1073742037 10:106418438-106418460 CACTTTTCGATGGGATTATTTGG - Intergenic
1073820623 10:107259400-107259422 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1074131048 10:110576063-110576085 CAGTTTATGATAGGTTTATTAGG - Intronic
1075341785 10:121652520-121652542 CGCTTTTTGATGGGATTATTTGG - Intergenic
1075824132 10:125339473-125339495 CACTTTTTGATGAGATTGTTTGG - Intergenic
1076077176 10:127543352-127543374 CACTTTTTGATGGGATTGTTTGG + Intergenic
1076223632 10:128755938-128755960 CAGTTTCTGATTGGAAGGTTTGG + Intergenic
1077775132 11:5262534-5262556 CACTTTTTGATGGGGTCGTTAGG - Intronic
1078518125 11:12041928-12041950 CACTTTCTGCTATGATCGTGAGG - Intergenic
1078647545 11:13155378-13155400 CACTTTCTAATGGGGTGGTTTGG + Intergenic
1079584287 11:22106734-22106756 CACTTTCTGCCATGATTGTGAGG + Intergenic
1079707092 11:23634532-23634554 CACTTTTTGATGGAGTTGTTTGG - Intergenic
1079836862 11:25346477-25346499 CACTTTTTAATGGGATTGTTTGG + Intergenic
1080047575 11:27825556-27825578 CACTTTTTAATGGGATTATTTGG + Intergenic
1080232641 11:30035083-30035105 CACCTTCTGCCACGATTGTTAGG - Intergenic
1080670210 11:34369591-34369613 CACTTTTTGATGGGATTGTTTGG - Intergenic
1080794240 11:35548699-35548721 CACTTTTTAATGGGATTGTTTGG + Intergenic
1080903576 11:36518671-36518693 CACTTTTTGATGGGGTTATTTGG + Intronic
1081238774 11:40678722-40678744 CATCTTCTGCCAGGATTGTTAGG + Intronic
1081282785 11:41230924-41230946 CACTTGTTGATGGGGTTGTTTGG - Intronic
1081284636 11:41252755-41252777 CACCTTCTGCTATGATTGTGAGG - Intronic
1081332126 11:41816499-41816521 CATTTTCTGACAGGATTTATAGG - Intergenic
1081376860 11:42369008-42369030 CACTTTCTGCCATGATTGTGAGG + Intergenic
1081459182 11:43255548-43255570 CTCTTTTTGATGGGGTTGTTTGG - Intergenic
1082127098 11:48446398-48446420 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1082575901 11:54802944-54802966 CACTTGTTGATGGGGTTGTTTGG - Intergenic
1082763287 11:57146778-57146800 GCCTGTCTCATAGGATTGTTAGG + Intergenic
1082947858 11:58779600-58779622 CACTTTCTGCCATGATTGTGAGG - Intergenic
1083065053 11:59915705-59915727 CACATTCTGACATGATTGTGAGG - Intergenic
1083102347 11:60321607-60321629 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1083522281 11:63325743-63325765 CACTTTTTCATAGGGTTGTTTGG - Intronic
1084247095 11:67865537-67865559 CACTTTTTGATGGGATTGTTTGG + Intergenic
1084338660 11:68477313-68477335 CACTTTATGATAGACTTATTGGG + Intronic
1085343917 11:75753791-75753813 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1085406427 11:76265829-76265851 CCCTTTCTGATTGGATTTTGGGG + Intergenic
1085540761 11:77267627-77267649 CATTTTCTAATTGGATTGTTTGG + Intronic
1086303424 11:85454361-85454383 CACTTTTTAATAGTATTGTTTGG + Intronic
1086430244 11:86730279-86730301 CACTTCTTGATAGGGTTTTTTGG + Intergenic
1086497119 11:87415932-87415954 CACTTTTTAATGGGATTATTTGG - Intergenic
1086502837 11:87471148-87471170 CACTTTCTGCCATGATTGTAAGG + Intergenic
1086819409 11:91416583-91416605 CACTTTTTGATGGAAATGTTCGG - Intergenic
1086829646 11:91544186-91544208 CACTTTTTGATAGGGTTGTTTGG + Intergenic
1086972921 11:93102969-93102991 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1087064385 11:94013540-94013562 CTCTTTTTGATAGGATTATTTGG - Intergenic
1087310211 11:96532909-96532931 CACTTTTTAGTAGGGTTGTTTGG - Intergenic
1087630978 11:100649685-100649707 CATCTTCTGACATGATTGTTAGG + Intergenic
1087848745 11:103003960-103003982 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1088005285 11:104932381-104932403 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1088143548 11:106648365-106648387 CACTTTCAGCTATGATTGTGAGG - Intergenic
1088145148 11:106668194-106668216 CACTTACTAATGGGATTATTTGG - Intergenic
1088161565 11:106877941-106877963 CACTTTTTAATGGGTTTGTTTGG - Intronic
1088167073 11:106951570-106951592 CACTTTATGATGGGGTTGTTTGG + Intronic
1088525578 11:110749658-110749680 CAGTTTTTGATGGGATTATTTGG + Intergenic
1088842328 11:113637629-113637651 CACTTTTTAATAGGATCGTGTGG - Intergenic
1089598212 11:119596000-119596022 CACTTTCTGAGAGATTTGTTTGG - Intergenic
1089711436 11:120317635-120317657 CTCTTTCTGACATGAGTGTTTGG - Intronic
1089819854 11:121214858-121214880 CACTTTTGGATGGGATTGTTTGG - Intergenic
1090103315 11:123824974-123824996 CATTTTTTGATGGGGTTGTTTGG + Intergenic
1090317835 11:125811645-125811667 CATTTATTGATAGGATTATTAGG + Intergenic
1090360447 11:126168809-126168831 CACCTTCTGCTATGATTGTGAGG - Intergenic
1090504791 11:127299097-127299119 CACTTTCTGCCATGATTGTGAGG + Intergenic
1090695421 11:129236400-129236422 CACTTTTTTGTGGGATTGTTTGG + Intronic
1090883588 11:130856392-130856414 CACTTTTTGATGGGGCTGTTTGG + Intergenic
1091367811 11:135037055-135037077 AACTCTCTGAGGGGATTGTTAGG - Intergenic
1091808673 12:3376889-3376911 CACTTTCTGCCATGATTGTGAGG + Intergenic
1091873126 12:3911760-3911782 CACCTTCTGCCAGGATTGTAAGG + Intergenic
1093604113 12:21068866-21068888 CACTTTTTGATGAGATTGTTTGG + Intronic
1093650220 12:21634575-21634597 CACTACCTTATAGGATAGTTGGG + Intergenic
1093660403 12:21750182-21750204 CACTTTTTGATGGGATTGTTTGG - Intronic
1093787898 12:23213991-23214013 CACTTTTTAATTGGGTTGTTTGG + Intergenic
1094127279 12:27036268-27036290 CACTTTTTGATGGGGTTGTTTGG + Intronic
1094282327 12:28754036-28754058 CACTTTCTGCCATGATTGTAAGG - Intergenic
1094290239 12:28840118-28840140 CACTTTCTACCAGGATTGTGAGG + Intergenic
1094342504 12:29428630-29428652 TACTTACTGATAGGAAAGTTAGG + Intronic
1094694070 12:32799072-32799094 CACTTTTTGATGGAATTATTTGG - Intronic
1095687856 12:45055811-45055833 CACTTTTTCATATGTTTGTTGGG - Intergenic
1095912285 12:47440699-47440721 CATTTTCTAATTGGATTCTTTGG - Intergenic
1095920746 12:47527213-47527235 CACTTTTTAATGGGATTATTTGG + Intergenic
1096066051 12:48741609-48741631 TAATTTCTGATAAGATTCTTTGG + Intergenic
1096968238 12:55645942-55645964 CACTTTTTAGTAGGATTGTTTGG + Intergenic
1097371284 12:58784602-58784624 CACTTTTTGATGGGATTGTTCGG - Intronic
1097662044 12:62440623-62440645 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1098058008 12:66528953-66528975 CACTTTTTGATGGGATTGTTTGG - Intronic
1098145617 12:67494960-67494982 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1099261750 12:80391101-80391123 CACTTTTTGATGGAGTTGTTTGG - Intergenic
1099680078 12:85815773-85815795 CACTTTTTTATGGGATTGTTTGG + Intronic
1099808920 12:87555869-87555891 CACTTTTTGATGGGGTTATTTGG - Intergenic
1099881922 12:88477535-88477557 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1100032725 12:90212999-90213021 CAGATTCTGGTAGGATTCTTGGG + Intergenic
1100714837 12:97294730-97294752 CACTTTCTGCCATGATTGTGAGG + Intergenic
1100937233 12:99682977-99682999 CACCTTCTGCCATGATTGTTAGG - Intronic
1101024768 12:100590227-100590249 CAGTTTTTGATGAGATTGTTTGG - Intronic
1101293324 12:103394649-103394671 CCCTTATTGATAGAATTGTTGGG - Intronic
1103310841 12:120006576-120006598 CAATTTTTGATAGGATTCTCAGG + Intronic
1104290434 12:127461456-127461478 CATTTTCTGATGGGATTGCTGGG + Intergenic
1104701865 12:130911055-130911077 AACTTTATGATGGGCTTGTTGGG - Intergenic
1105315021 13:19250438-19250460 CACTATTTGATGGGATTGTTTGG - Intergenic
1105425334 13:20289615-20289637 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1105471463 13:20698656-20698678 GACTTTGTGATAGGCTTATTGGG - Intergenic
1106042776 13:26109672-26109694 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1106462526 13:29984632-29984654 CATTTTTTAATAGGATTATTTGG + Intergenic
1106859278 13:33887465-33887487 CACTTTTTGATGGTGTTGTTTGG + Intronic
1107161974 13:37240810-37240832 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1107244596 13:38278486-38278508 CACTTTTTAATAGGGTTGTTTGG + Intergenic
1107270141 13:38606696-38606718 GTCTTCCTTATAGGATTGTTTGG - Intergenic
1107358518 13:39594277-39594299 CACTTTTTGATGGGGTTGTGTGG - Intronic
1107582310 13:41803475-41803497 CACTTTCTGCCATGATTGTGAGG - Intronic
1107820931 13:44285116-44285138 CACTTTTTGATGGGGTTGTTGGG - Intergenic
1108288573 13:48933872-48933894 CACTTTTTGATGGAATTGTTGGG + Intergenic
1108384322 13:49884999-49885021 CACTTTTTGATGGGATTGTTTGG - Intergenic
1108814873 13:54278252-54278274 CATTTTTTAATAGGATTATTTGG + Intergenic
1108850795 13:54727104-54727126 CACTTTCTGCCATGATTGTGAGG + Intergenic
1108866116 13:54924706-54924728 CACTTTTTAATGGGATTATTTGG + Intergenic
1108936641 13:55890537-55890559 CACCTTCTGCTATGATTGTGAGG - Intergenic
1108985153 13:56577372-56577394 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1109152632 13:58862359-58862381 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1109203928 13:59461001-59461023 GACTTTCTGATGGCATAGTTTGG - Intergenic
1109366990 13:61368591-61368613 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1109372433 13:61440835-61440857 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1109391956 13:61705266-61705288 CACCTTCTGCTATGATTGTGAGG + Intergenic
1109596697 13:64565377-64565399 CACTTTTTGGTGGGATTATTTGG + Intergenic
1109644509 13:65235917-65235939 CACTTTTTGATGGGATTATTTGG + Intergenic
1110025690 13:70536074-70536096 AACTTTCTGATGGGCTTATTGGG + Intergenic
1110199226 13:72829108-72829130 CACTTTTTGATGGGGTTGTTTGG + Intronic
1110290352 13:73798575-73798597 CACATTTTAATGGGATTGTTTGG - Intronic
1110516969 13:76425135-76425157 GACTTTGTGATAGGTTTATTGGG + Intergenic
1110620427 13:77588245-77588267 ATCTTTCTAATAGGATTGTTGGG - Intronic
1110779767 13:79451377-79451399 CACTTACTGATAACATTTTTGGG + Intergenic
1111148860 13:84221742-84221764 CACTTTTTGATGGGATTGTTTGG - Intergenic
1111312552 13:86508404-86508426 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1111324978 13:86682561-86682583 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1111379879 13:87435362-87435384 CACTTTATGATAGGGTTATTTGG - Intergenic
1111398510 13:87700302-87700324 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1111412727 13:87897196-87897218 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1111464114 13:88585696-88585718 CACTTTCTGAGATGATTATGAGG + Intergenic
1111628437 13:90818485-90818507 CACTTTCTGATGTGGTTGTTTGG - Intergenic
1111792402 13:92874861-92874883 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1112115619 13:96349430-96349452 CACTTTTGGAGAGAATTGTTTGG - Intronic
1112242006 13:97691638-97691660 CACTTTTTAATGGGGTTGTTAGG - Intergenic
1112704840 13:102055868-102055890 CACTTTCTGCCATGATTGTGAGG - Intronic
1113359714 13:109619111-109619133 CACTTTCTGCCATGATTGTGAGG - Intergenic
1113798194 13:113071219-113071241 CATTTTCTAACTGGATTGTTTGG + Intronic
1114171282 14:20274419-20274441 CACTTTCTGCCATGATTGTAAGG - Intronic
1114361000 14:21972607-21972629 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1114579007 14:23739427-23739449 CAGTTTTTGATGGGGTTGTTTGG + Intergenic
1114885861 14:26850334-26850356 GACTGTCTGATAGTATTGCTAGG - Intergenic
1114956142 14:27822033-27822055 CACTTTTTGATGGGATTGTTTGG - Intergenic
1114971885 14:28041568-28041590 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1115076820 14:29403021-29403043 CACCTTCTGCTATGATTGTGAGG - Intergenic
1115391904 14:32863263-32863285 CACTTTCTAATGGGGTTGTTTGG + Intergenic
1115784886 14:36814481-36814503 CACTTTTTGATGGGGTTGTTTGG - Intronic
1115838703 14:37441089-37441111 CACTTTGTAATGGGATTATTTGG + Intronic
1115973910 14:38976018-38976040 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1116088601 14:40274725-40274747 CACTTTTTGATAGGATTATTTGG + Intergenic
1116219685 14:42067159-42067181 CACTTTTTAATGGAATTGTTTGG + Intergenic
1116281663 14:42915794-42915816 CACTTTCTGCCATGATTGTGAGG - Intergenic
1116304296 14:43230679-43230701 CACTTTTTGATGGGATTGTTTGG + Intergenic
1116320038 14:43449738-43449760 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1116784625 14:49273729-49273751 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1116980353 14:51163511-51163533 CATTCTCTGATAGGATTTGTAGG - Intergenic
1117012066 14:51481302-51481324 CACTTTCTGCCATGATTGTGAGG - Intergenic
1117506147 14:56405019-56405041 CACTCATTGATAGGATTATTTGG + Intergenic
1117518024 14:56522041-56522063 CACTTTTTGATGGAATTATTTGG + Intronic
1117822823 14:59668765-59668787 CACTTTTTGATGGGATTGTTTGG - Intronic
1118644855 14:67828321-67828343 CACTTTTTAATGGGGTTGTTTGG + Intronic
1119029245 14:71178728-71178750 CACATGCTGACAGGAATGTTTGG - Intergenic
1119632051 14:76241238-76241260 CACTTTTTGATGGGATGATTTGG - Intronic
1120224013 14:81769872-81769894 CATTTTTTGATGGGTTTGTTTGG - Intergenic
1120304949 14:82757855-82757877 CACCTTCAGATTGGATTGTTTGG - Intergenic
1120448597 14:84635675-84635697 CACTTTTTAATTGGGTTGTTTGG + Intergenic
1121848718 14:97198960-97198982 CACTTCCTGATTGGATCATTTGG - Intergenic
1122358723 14:101143298-101143320 CACTTTTTGATGGAGTTGTTTGG + Intergenic
1124203897 15:27701304-27701326 CACTTTTTAATTGGATTATTTGG + Intergenic
1124479683 15:30067640-30067662 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1125208777 15:37186624-37186646 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1125456462 15:39864848-39864870 CACTTTTTAATGGGATTATTGGG - Intronic
1126718507 15:51549790-51549812 CATTTTTTGATGGGATTGTTTGG + Intronic
1127190328 15:56523608-56523630 CACTTTTTAATGGGATTATTTGG - Intergenic
1127222812 15:56898320-56898342 CACTTTTTAATGGGGTTGTTTGG - Intronic
1127280101 15:57482088-57482110 CATTTCCTAATTGGATTGTTTGG + Intronic
1128666574 15:69542553-69542575 CAGTTTCTGATGGGATGGCTGGG + Intergenic
1129559244 15:76549106-76549128 CACTTTTTGATGGGGTTGTTTGG - Intronic
1129796048 15:78376792-78376814 CACTTTTTGATGGGGTTCTTTGG + Intergenic
1130380812 15:83371131-83371153 CACTCTCTCATAGGTTTGGTGGG - Intergenic
1130777474 15:87000057-87000079 CACTTTTTGATGGGGTTGTTTGG + Intronic
1131715847 15:95110116-95110138 CACCTTCTGCTATGATTGTGAGG + Intergenic
1132206728 15:99991331-99991353 CACTTTTTGATGGGGTTGTTTGG - Intronic
1132254452 15:100363626-100363648 TACTTTTTGATGGGGTTGTTTGG - Intergenic
1132912623 16:2322965-2322987 CACTTTTTGATGGGGTTGTTTGG - Intronic
1133951153 16:10393691-10393713 CAATTTCTGATAGGTTTTTTGGG + Intronic
1134193035 16:12137152-12137174 CATTTTTTCCTAGGATTGTTGGG + Intronic
1135782486 16:25316516-25316538 CACTTTTTAATAGGGTTGTTTGG - Intergenic
1136645856 16:31614213-31614235 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1136651159 16:31672756-31672778 TACTTTTTGATGGGATTATTTGG + Intergenic
1136694964 16:32070682-32070704 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1136795467 16:33013942-33013964 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1136874459 16:33840435-33840457 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1137075198 16:35953222-35953244 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1137809025 16:51335103-51335125 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1137835289 16:51586327-51586349 CAATTTCAGATAGGGTTATTAGG - Intergenic
1137897045 16:52224998-52225020 CACTTTGTAATGGGGTTGTTTGG + Intergenic
1138042261 16:53685026-53685048 CACTTTGTAATGGGGTTGTTTGG - Intronic
1138724012 16:59116377-59116399 AAATCTCTGAAAGGATTGTTAGG + Intergenic
1138810859 16:60148864-60148886 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1138830578 16:60369683-60369705 CACCTTCTGCTATGATTGTGAGG + Intergenic
1139017424 16:62707078-62707100 CATTTTCTGATAGCATTTTATGG - Intergenic
1139091917 16:63658912-63658934 CACTTTTTGGTGGGGTTGTTTGG + Intergenic
1139985733 16:70897161-70897183 CACTTTTTGATGGGATTATTTGG - Intronic
1140316582 16:73903845-73903867 CACTTTTGGATAGGACTGTTTGG + Intergenic
1140344825 16:74202988-74203010 CTCTTTCAAATAGGATGGTTAGG - Intergenic
1140568966 16:76079373-76079395 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1140883881 16:79225689-79225711 CACTTTTTGATGGGGTTGTGTGG - Intergenic
1140900270 16:79360508-79360530 CACTACCTGTTAGGATTGTTGGG + Intergenic
1141037053 16:80636370-80636392 CACTTTTTGATGGGGTTGTTTGG - Intronic
1141557127 16:84843593-84843615 CCCTTTCTCATAGGGTTGTTTGG + Intronic
1203097719 16_KI270728v1_random:1275604-1275626 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1143337524 17:6184259-6184281 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1145820808 17:27833415-27833437 CACTTTCTGCTATGACTGTGAGG - Intronic
1146128632 17:30250402-30250424 CATTTTTTGATGGGATTATTTGG - Intronic
1146600480 17:34210578-34210600 CACTTTTCGATGGGGTTGTTTGG + Intergenic
1147529146 17:41257691-41257713 CACTTTCTAATGAGATTGTTTGG + Intergenic
1148871545 17:50661374-50661396 CAATTCCGCATAGGATTGTTGGG - Intronic
1149052829 17:52326618-52326640 CACTTTCTACTATGATTGTGAGG - Intergenic
1149090394 17:52771337-52771359 CACTTTTTAACAGGGTTGTTTGG - Intergenic
1149303710 17:55328673-55328695 CACCTTCTGCTAGGATTGTGAGG - Intergenic
1149359703 17:55881914-55881936 CAGCTTCTGATTTGATTGTTAGG + Intergenic
1149960993 17:61109770-61109792 CACTTTTTGATGTGATTGTTTGG + Intronic
1150176128 17:63058265-63058287 CACTTTTTAATGGGGTTGTTTGG + Intronic
1150329862 17:64286065-64286087 CACTTTCTGCCATGATTGTGAGG + Intergenic
1151280532 17:73070836-73070858 CACTTTCTGCCATGATTGTGAGG + Intronic
1151397951 17:73837062-73837084 CACTTTCTGCCATGATTGTGAGG + Intergenic
1152993406 18:383853-383875 CACTTTCTGCCATGATTGTGAGG - Intronic
1153087055 18:1300165-1300187 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1153612999 18:6906942-6906964 CACTTTCAAATTGGATTGTTTGG - Intronic
1153641992 18:7165367-7165389 CACTGAGTGATAGGGTTGTTAGG - Intergenic
1154138947 18:11806178-11806200 CACTTTTTAATGGGATTATTTGG + Intronic
1155079077 18:22389690-22389712 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1155708310 18:28843885-28843907 CACTTTTTGATGGGATTATTTGG + Intergenic
1155763143 18:29591055-29591077 CACTTTTTGATGGGGTCGTTTGG - Intergenic
1155967234 18:32047734-32047756 CACTTTCTGAAAGGATTTTATGG - Intronic
1156172262 18:34499793-34499815 CATTTTCTATTTGGATTGTTTGG + Intronic
1156343424 18:36233865-36233887 CACTTTTTGATGAGATTATTTGG + Intronic
1156505959 18:37593108-37593130 GACTTTTTGATAGGTTTATTGGG + Intergenic
1156894848 18:42234357-42234379 CACTTTTTGTTGGGACTGTTTGG - Intergenic
1156965272 18:43084045-43084067 CACTTTTTGATGGGGTTGTTTGG - Intronic
1157065099 18:44340470-44340492 CAATTTTTGATGGGATTATTTGG + Intergenic
1157663352 18:49465098-49465120 CCCTTTCTCATAGGGTTATTTGG - Intergenic
1157782933 18:50456364-50456386 CACCTTCTGGTATGATTGTGAGG - Intergenic
1157945463 18:51974739-51974761 CATTTTTTAATGGGATTGTTTGG + Intergenic
1158181580 18:54721810-54721832 CATTTTCAGTTAGGGTTGTTTGG + Intronic
1158785744 18:60710186-60710208 GACTTTATGATGGGTTTGTTGGG - Intergenic
1159539318 18:69755597-69755619 CATTTTATGAAAGGATTATTAGG - Intronic
1160109235 18:76009713-76009735 CACTTTTTAATGGGTTTGTTTGG + Intergenic
1160241516 18:77127689-77127711 TACTTTTTAATTGGATTGTTTGG - Intronic
1161200367 19:3011212-3011234 CAGTTTCTGATCAGATCGTTGGG - Intronic
1164395260 19:27857967-27857989 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1165965739 19:39578238-39578260 CACTTTTTAATGGGATTGTTTGG + Intergenic
1165983020 19:39741380-39741402 CACTTTTTGATAGGACTGTTTGG + Intergenic
1165987569 19:39783814-39783836 CACTTTTTGATGGAATTGTTTGG + Intronic
1166291487 19:41866442-41866464 CACTCTCTGGCAGGATTGTGGGG + Intronic
1166479729 19:43160791-43160813 CACTTTTTGATGGGCTTGTTTGG + Intronic
1166603809 19:44121824-44121846 CACTTTTTGATGGGGTTGTTTGG + Intronic
1166985642 19:46658971-46658993 TACTTTCTAATAGGAATGATGGG - Intronic
1167297935 19:48662765-48662787 CACTTTCTGAGAGGCTGGGTGGG + Intronic
925126987 2:1464730-1464752 CACTTTTTGATGGGATTGTTTGG + Intronic
925536361 2:4922194-4922216 CACTTTCTGCCATGATTGTAAGG - Intergenic
925590352 2:5503119-5503141 CACAGTATGATAGGATTGCTTGG + Intergenic
925619338 2:5775761-5775783 CATTTTTTAATTGGATTGTTAGG - Intergenic
925655836 2:6148023-6148045 CACTTTCTCATCTGACTGTTTGG - Intergenic
925706477 2:6688626-6688648 CACTTTTTGATAGGGGTGTTTGG - Intergenic
925848566 2:8056954-8056976 CACTTTTTCATTGGATTGTTTGG + Intergenic
926319300 2:11737546-11737568 CACTTTTTGATGGGGTTGTTTGG - Intronic
926336587 2:11867234-11867256 CACCTTCTGCTATGATTGTGAGG + Intergenic
926340780 2:11902813-11902835 CACTTTCTGAAAGGCATGTCTGG - Intergenic
926516141 2:13849620-13849642 CACTTTTTGATGGGGTTGTTTGG + Intergenic
926696762 2:15775296-15775318 CACTTTTTGATGGGATTGTTTGG + Intergenic
926979225 2:18549436-18549458 CACCTTCTGCTATGATTGTTAGG + Intergenic
927189452 2:20507143-20507165 CATTTTCTAATTGGACTGTTTGG - Intergenic
927235011 2:20865054-20865076 CACTTTTTAATACGGTTGTTTGG - Intergenic
928119771 2:28575343-28575365 CACTTTTTGATGGGATTATTTGG + Intronic
928339374 2:30428348-30428370 TTCTCTCTGATAGGATTTTTAGG + Intergenic
928412151 2:31062892-31062914 CACTTTTTGATAGGGTTGTTTGG + Intronic
928616508 2:33044941-33044963 CACTTTTTGATGGGGTTGTTTGG + Intronic
929064264 2:37957474-37957496 CACTTTTTGATAGGGTTGTTTGG + Intronic
929991321 2:46790584-46790606 CACTTACTGAGAGGAATTTTGGG - Intergenic
930567863 2:53045781-53045803 TTCTTTTTGATAAGATTGTTTGG + Intergenic
930996872 2:57729928-57729950 CACTTTTTAATAGAATTGTTTGG + Intergenic
931041221 2:58303436-58303458 CAATTTCTGTTAGGGTTCTTTGG + Intergenic
931211570 2:60201733-60201755 CACTTTTTGGTGGGGTTGTTTGG + Intergenic
931231540 2:60379282-60379304 GACTATCTCATAGGGTTGTTGGG - Intergenic
931413128 2:62054011-62054033 CACTTTTTAGTAGGATTATTTGG - Intronic
931502834 2:62889209-62889231 CACTTTTTAATGGGGTTGTTTGG + Intronic
932015024 2:68017125-68017147 CGCTTTTTGATGGGGTTGTTTGG - Intergenic
933129959 2:78660096-78660118 CACTTTTTGATGGGGTTGTTTGG - Intergenic
933557510 2:83849286-83849308 CACTTTTTGATGGGGTTGTTTGG + Intergenic
934478662 2:94613910-94613932 CACTTTTTAATAGGATTGTCTGG + Intergenic
934482591 2:94665187-94665209 CACTTTCTGCAATGATTGTGAGG - Intergenic
934535070 2:95126683-95126705 CATTTTCTAGTTGGATTGTTTGG + Intronic
935034370 2:99354364-99354386 CATTTTTTAATTGGATTGTTTGG + Intronic
935120699 2:100181145-100181167 CCCTTTCTTAAAGGATCGTTTGG + Intergenic
935246742 2:101225391-101225413 CACTTTCTGCAATGATTGTGAGG - Intronic
935412246 2:102776975-102776997 CAGTTTCTAATTGGATTGTTTGG + Intronic
935484200 2:103632638-103632660 CACTTTTTGATGGGGTTGTTTGG + Intergenic
935557829 2:104529785-104529807 CACTTTTTAATAAGGTTGTTGGG - Intergenic
935965216 2:108466113-108466135 CACTTTTTAATGGGATTATTTGG + Intronic
936100590 2:109575027-109575049 AACTTTATGATAGGTTTATTGGG - Intronic
936259348 2:110945177-110945199 CACTTTTTAACAGAATTGTTTGG + Intronic
936772017 2:115924974-115924996 CATTTTTTGATAGGATTTTGTGG + Intergenic
936816002 2:116461641-116461663 CATTTTGTAATAGGATTCTTTGG - Intergenic
936845630 2:116827990-116828012 CAATTTCTAATTGGATTTTTTGG + Intergenic
936848542 2:116868145-116868167 CACTTTTTGATGGAGTTGTTTGG + Intergenic
936868328 2:117103469-117103491 CACTTTTTAATAAGATTGTTTGG + Intergenic
936869919 2:117124305-117124327 CACTTTTTATTAGGAATGTTTGG - Intergenic
937607976 2:123825474-123825496 CACTTTTTAATGGTATTGTTTGG - Intergenic
937617066 2:123937349-123937371 CACTTTTTAATGGTATTGTTTGG + Intergenic
937702796 2:124882803-124882825 CACCTTCTGCTATGATTGTGAGG - Intronic
937709400 2:124961883-124961905 CATTTTCTAATGGAATTGTTTGG - Intergenic
937730198 2:125221622-125221644 CACTTTCTGTGATGATTGTGAGG - Intergenic
937736010 2:125290345-125290367 CATTTTTTCATATGATTGTTGGG - Intergenic
937921294 2:127133462-127133484 CTCTTTCTGATGGGACTGTGGGG - Intergenic
937972036 2:127558158-127558180 CACTTTTTGATGGGATTGTTTGG - Intronic
938947802 2:136229195-136229217 CACTTTTTGATGGGATTGTTTGG - Intergenic
939226603 2:139372498-139372520 CACTTTTTGATGGGGTTGTTTGG - Intergenic
939449663 2:142357120-142357142 CACTCTTTGATGGGATTGTTTGG - Intergenic
939727391 2:145739627-145739649 CACTTTCTGCTAGGCTGATTTGG + Intergenic
939831190 2:147073033-147073055 CACTTTTTAATTGGATTATTTGG + Intergenic
940171941 2:150838199-150838221 CACTTTTTAATGGGATTGTTTGG + Intergenic
940257687 2:151748642-151748664 CACTTTTTGATGGAGTTGTTTGG - Intergenic
940416994 2:153434658-153434680 CACTTTTTGATGGGGTTGTTTGG + Intergenic
940628729 2:156210270-156210292 CACTTTATAATGGGATTGTTTGG + Intergenic
940679140 2:156762201-156762223 CACTTTTTGATGGGATTGTTTGG - Intergenic
940825757 2:158409993-158410015 CACTTTCTGCCATGATTGTGAGG + Intronic
941278678 2:163522739-163522761 CACTTTTTAATAGGGTTGCTTGG + Intergenic
941520727 2:166538685-166538707 CACTTTTTAATGGGATTGTTTGG + Intergenic
941680076 2:168388398-168388420 CACGTTTTGATGGAATTGTTTGG - Intergenic
941707753 2:168677854-168677876 CACTTTCTGATGGGGTTGTTTGG - Intronic
942643304 2:178083591-178083613 CACTTTCTGGTAGGGGTCTTTGG - Intronic
942760647 2:179393526-179393548 CACTTTTTAATAGGATTGCTTGG - Intergenic
942882301 2:180875925-180875947 CACTTTCTGCTATCATTGTGAGG - Intergenic
943039271 2:182784779-182784801 AACTTTCTCAAAGGATTTTTAGG + Exonic
943395938 2:187334397-187334419 CACTTTTTAATAGGGTTATTTGG - Intergenic
943714729 2:191138168-191138190 CACTTTTTAATGGGATTATTTGG - Intronic
944438325 2:199715504-199715526 CACTTTCTGCTGTGATTGTGAGG + Intergenic
944463890 2:199981179-199981201 CACTTTTTGATGGGATTGTTTGG - Intronic
944587803 2:201188054-201188076 GACTTCCTTCTAGGATTGTTGGG + Intronic
944934437 2:204553068-204553090 CTCTTTTTGATGGGATTGTTTGG - Intronic
945387417 2:209219526-209219548 CACTTTTTGATGGGATTAATTGG - Intergenic
945678766 2:212887762-212887784 CACTTTTTGATGGGGTTGTTTGG - Intergenic
945770750 2:214039373-214039395 CACTTTTTAATGGGGTTGTTTGG + Intronic
946108376 2:217391949-217391971 CACTTTCTGCCATGATTGTGAGG - Intronic
946204856 2:218096994-218097016 CACTTTTTGACAGGATTATTTGG + Intergenic
946263332 2:218515850-218515872 CACTTTTGGATGGGATTGTTTGG - Intronic
946999976 2:225442923-225442945 CACCTTCTGCTATGATTGTGAGG - Intronic
947069904 2:226277233-226277255 CATTTTCTAATTGAATTGTTTGG - Intergenic
947093586 2:226541461-226541483 CACCTTCTGCTATGATTGTGAGG - Intergenic
947582296 2:231328234-231328256 CATTTTCTAATTAGATTGTTTGG + Intronic
948022543 2:234747946-234747968 CACTTTCTGCCATGATTGTGAGG - Intergenic
1169295226 20:4390960-4390982 CATTTTCTAATAGGATTTTTTGG - Intergenic
1169398476 20:5258402-5258424 TATTTTCTAATAGGATTTTTTGG - Intergenic
1169528661 20:6459518-6459540 CACTTTTTGATGGGATTGTTTGG - Intergenic
1169677935 20:8175837-8175859 CATTTTCTAAATGGATTGTTTGG - Intronic
1170162486 20:13328119-13328141 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1170238362 20:14133583-14133605 CCATTTCAGATAGGTTTGTTAGG + Intronic
1170435722 20:16326480-16326502 CACTTTTTGATGGGATTATTTGG - Intronic
1170489048 20:16852605-16852627 AACTTTTTGATGGGATTATTTGG + Intergenic
1170719997 20:18868255-18868277 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1170763652 20:19273054-19273076 CAGATTCTGCTATGATTGTTGGG - Intronic
1170869104 20:20188316-20188338 CTCATTTTGATATGATTGTTTGG - Intronic
1170959844 20:21015712-21015734 CACTTTCTGATTGGTTTCCTAGG + Intergenic
1171082559 20:22202294-22202316 CACTTTTTAATAGGGTTGGTTGG - Intergenic
1172925853 20:38534372-38534394 CTCTTTCTGATAGGATCGACAGG + Intronic
1173044395 20:39495569-39495591 CACTTTTTAATAGGATATTTGGG - Intergenic
1173771157 20:45659542-45659564 TACTTTTTGATGGGGTTGTTTGG + Intronic
1174893630 20:54425583-54425605 CACTTTTTGATGGGATTATTTGG - Intergenic
1175732551 20:61363959-61363981 CAGTGTATGATGGGATTGTTAGG + Intronic
1176531174 21:7959699-7959721 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1176659378 21:9619885-9619907 CACTTTCTGCCATGATTGTGAGG - Intergenic
1176988355 21:15464124-15464146 CATTTTTTGATGGGATTGTTTGG - Intergenic
1177063988 21:16406491-16406513 CACTTGCTGTTAGGATTTCTGGG + Intergenic
1177070338 21:16497833-16497855 CACTTTTTGATGGGATTGTTTGG + Intergenic
1177269943 21:18834569-18834591 CACTTTTTGATGGAGTTGTTTGG + Intergenic
1177315118 21:19450050-19450072 CACTTTTTAATAGGGTTGTTTGG - Intergenic
1177545894 21:22558860-22558882 CACTTTTCAATGGGATTGTTTGG + Intergenic
1177817089 21:25989053-25989075 CATTTTGTGATAGGAACGTTGGG - Intronic
1179933477 21:44588186-44588208 CACTTTTTGATGGGATTGTTTGG - Intronic
1180261984 21:46677242-46677264 CACTTTTTGATGAGGTTGTTTGG + Intergenic
1180596717 22:16980322-16980344 CCCTTTTTGATGGGATTGTTTGG - Intronic
1181736759 22:24888026-24888048 CACCTTCTAATTGGATTGTTTGG + Intronic
1182790218 22:32945852-32945874 CACTTTTTGATCGCCTTGTTTGG - Intronic
1182814548 22:33148897-33148919 CATTTTCTAATGAGATTGTTTGG + Intergenic
1182817282 22:33176467-33176489 CACTTTTTGATGGGGTTGTTTGG - Intronic
1182889084 22:33801531-33801553 CATTTTCTAATTGGATTGTTTGG + Intronic
1182955489 22:34420658-34420680 CATTTTCTAATTTGATTGTTTGG + Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
1183761519 22:39823973-39823995 CATTTTCTAATTGGACTGTTTGG + Intronic
1184962592 22:47942358-47942380 CACCTTCTGCCAGGATTGTGAGG - Intergenic
1185192151 22:49445690-49445712 CACTTTCTGCCATGATTGTGAGG - Intronic
949636081 3:5982626-5982648 CACCTTCTGCTATGATTGTGAGG - Intergenic
949758503 3:7441320-7441342 CACTTTTTAATAAGATTATTTGG + Intronic
949804482 3:7939544-7939566 CACGTTTTGATGGGGTTGTTTGG - Intergenic
949944184 3:9177268-9177290 AAATTTCTTATAGGATTATTTGG - Intronic
950472547 3:13195154-13195176 CATTTTCTAACTGGATTGTTTGG - Intergenic
950591953 3:13943006-13943028 CACTTTTTGATGGGATTGTTTGG + Intronic
951005758 3:17613716-17613738 CACTTTTTGATTTGGTTGTTTGG + Intronic
951154503 3:19333180-19333202 TATTTTCTAATTGGATTGTTTGG + Intronic
951776474 3:26315866-26315888 CACTTTTTGATGGGGTTGTTTGG - Intergenic
951964256 3:28364977-28364999 CACTTTTTGATGGGGTTGTTTGG + Intronic
951975239 3:28499478-28499500 CACTTTTTGATGTGGTTGTTTGG + Intronic
951987374 3:28635532-28635554 CACTTTTTAATGGGGTTGTTTGG + Intergenic
952022024 3:29034363-29034385 CATTTTCTAATTGGCTTGTTTGG + Intergenic
952096989 3:29965558-29965580 CACTTTTTGATGGGATTGTTTGG + Intronic
952143898 3:30510403-30510425 CACTTTTTAATAGGATTATTTGG + Intergenic
952199920 3:31115486-31115508 CACTTTTTAATTGGATTGTTTGG - Intergenic
952476044 3:33711685-33711707 CACTTTTTGATGGGATAATTTGG - Intronic
952588680 3:34924342-34924364 AACTTTTTGATGGGGTTGTTTGG - Intergenic
953004138 3:38961712-38961734 ATTTTTCTGATAGGATTGTTTGG + Intergenic
953080637 3:39614080-39614102 CACTTTTTGATGGAATTATTTGG - Intergenic
953082655 3:39635191-39635213 CACTTTCTGCCATGATTGTGAGG + Intergenic
953297654 3:41736522-41736544 CACTTTGTGATGGGGTTGTTTGG + Intronic
953300840 3:41774383-41774405 CACTTTGTGATGGGGTTGTTTGG - Intronic
953544040 3:43848850-43848872 CACTTTTTGATGGAGTTGTTAGG - Intergenic
953812184 3:46122708-46122730 CATTTTCTAATTGGATTGTTTGG + Intergenic
954018957 3:47721700-47721722 CACTTTCTTTTAAGATAGTTAGG - Intronic
954411132 3:50371701-50371723 TCCTTTCTGATAGGACTGTGAGG + Intronic
954976395 3:54699211-54699233 CTCTCTCTGATAGGATGCTTGGG + Intronic
955257536 3:57349137-57349159 CACTTTTTTATGAGATTGTTTGG - Intronic
955336630 3:58092060-58092082 CATTTTCTTATTGGGTTGTTTGG - Intronic
955366470 3:58314397-58314419 CATTTTCTAATTGAATTGTTTGG - Intronic
955602420 3:60660798-60660820 CATTTTCTAATTGGACTGTTTGG + Intronic
955642493 3:61100890-61100912 CACTTTTTGATGGGTTTGTTTGG + Intronic
955946261 3:64197422-64197444 CACTTTTTAATGGGATTGTTTGG + Intronic
956171131 3:66434273-66434295 CATTTTCTAATTGGATTTTTTGG - Intronic
956322986 3:68019514-68019536 AACTTTTTCATAAGATTGTTTGG + Intronic
956973513 3:74553746-74553768 CATTTTTTGATGGGGTTGTTTGG + Intergenic
957785314 3:84874924-84874946 CACTTTTTAATGGGGTTGTTTGG + Intergenic
957865564 3:86018707-86018729 CACTTTTTGATGGGGTTGTTTGG + Intronic
958077194 3:88695843-88695865 CACTTTTTAATGGGGTTGTTTGG - Intergenic
958160957 3:89816357-89816379 CACTTTCTGCCATGATTGTGAGG - Intergenic
958627115 3:96640408-96640430 CACTTTTTGATGGGGTTGTTTGG + Intergenic
958673039 3:97229051-97229073 AACTTTTTGATGGGATTATTTGG + Intronic
958709440 3:97699423-97699445 CAGTACCTTATAGGATTGTTGGG - Intronic
959128326 3:102318639-102318661 CATTTTTTAATAGGGTTGTTTGG + Intronic
959222825 3:103543320-103543342 CACTTTTTGATGGGGTTGTTTGG + Intergenic
959360914 3:105390428-105390450 CACTTTTTAATGGGGTTGTTGGG + Intronic
959453176 3:106528054-106528076 CACTTTTTGATGGGGTTGTTTGG - Intergenic
959666077 3:108923004-108923026 CACTTTTTGGTGGGTTTGTTTGG + Intronic
959740151 3:109709356-109709378 CACTTTTTGATGGGATTATTTGG + Intergenic
959745487 3:109771650-109771672 CACTTTTTGATCCGATTTTTTGG - Intergenic
959750011 3:109822985-109823007 CACTTTTTGATGGGGTTGTTTGG - Intergenic
959875566 3:111378548-111378570 CTATTTTTGATAGGATTGTTTGG - Intronic
960118428 3:113921790-113921812 CACTTTTTTATTGGGTTGTTTGG + Intronic
960197594 3:114788826-114788848 CACTTTCTGCCATGATTGTGAGG - Intronic
960435258 3:117618845-117618867 ATCTATCTCATAGGATTGTTGGG - Intergenic
960787231 3:121387235-121387257 CACTTTTTGATGGGGTTGCTTGG + Intronic
961350479 3:126298280-126298302 CACTTCTTGATGGGATTATTAGG + Intergenic
961910195 3:130306915-130306937 CACTTTTTGATGGGATTGTTTGG - Intergenic
962480117 3:135790715-135790737 CACTTTTTGATGGGGTTATTTGG + Intergenic
962502944 3:136013685-136013707 CACTTTCTGATGGGATTGTTTGG + Intronic
962694636 3:137935833-137935855 CACTTTTTGATGGGGTTGTTTGG + Intergenic
962762162 3:138524574-138524596 CACTTGTTGATGGGGTTGTTTGG - Intronic
962997418 3:140644442-140644464 CACTTTCTGATGGGGTTGTTTGG + Intergenic
962999182 3:140661271-140661293 CACTTTTTAATGGGGTTGTTTGG - Intergenic
963053423 3:141162268-141162290 CACTTTTTAATGGGGTTGTTTGG - Intergenic
963623269 3:147639036-147639058 CACTTTTTGATGGGATCATTTGG - Intergenic
963819607 3:149874442-149874464 CCCTATATGATAGGATTGTTGGG + Intronic
963830382 3:150001432-150001454 CACTTTTTAATGGGATTGTTTGG - Intronic
964146271 3:153467357-153467379 CACTTGCTGATTGGGTGGTTTGG + Intergenic
964183806 3:153918609-153918631 CACTTTTTAATGGGGTTGTTTGG - Intergenic
964279682 3:155050661-155050683 CACTTTTTAATGGGGTTGTTTGG + Intronic
964347125 3:155765273-155765295 CACTTTCAGGTAGGACTTTTAGG - Intronic
964462396 3:156948992-156949014 CACTTTTTAATGGGCTTGTTTGG + Intronic
964486950 3:157195864-157195886 CACTTTTTGATCAGGTTGTTTGG - Intergenic
964595503 3:158422906-158422928 CACTTTTTGATGGGGTTGTTTGG + Intronic
964598868 3:158472671-158472693 CACTTTTTGATGGGGTTGTTTGG + Intronic
964838435 3:160967201-160967223 CACCTTCTGCTATGATTGTGAGG + Intronic
965271552 3:166622733-166622755 CACTTATTGATGGGGTTGTTTGG - Intergenic
965462204 3:168979774-168979796 CACTTTTTAATGGGGTTGTTTGG + Intergenic
965526176 3:169720796-169720818 CACTTTTTAATGGGGTTGTTTGG + Intergenic
965712594 3:171570765-171570787 CACTTTTCGATAGGATGGTTTGG + Intergenic
965752467 3:171990335-171990357 CACTTTCTGCCATGATTGTGAGG - Intergenic
965766965 3:172141054-172141076 ACCTATCTGATAGGATTGTGAGG + Intronic
965985400 3:174747239-174747261 CACATTCTGATGGGGTTGTTTGG - Intronic
966042077 3:175503759-175503781 CACTTTTTCATGGGGTTGTTTGG + Intronic
966231162 3:177653735-177653757 CACTTTTTAATGGGGTTGTTTGG - Intergenic
966339780 3:178912831-178912853 CACTTTCTTTCAGGATTGCTGGG - Intergenic
967122818 3:186398653-186398675 CACTTTTTAATGGGGTTGTTTGG + Intergenic
967203718 3:187100166-187100188 CACTTTTTGAAGGGATTATTTGG - Intergenic
967376523 3:188809512-188809534 CACTTTTTGATAAAGTTGTTTGG + Intronic
968418594 4:463066-463088 CACTTTTTGATGGGGTGGTTTGG - Intronic
968537031 4:1138880-1138902 CACTTTCAGATTGGGTTATTGGG + Intergenic
969505406 4:7583692-7583714 CACTTTCTGCCATGATTGTGAGG + Intronic
970070674 4:12155991-12156013 CACTTTTTGATGGAGTTGTTTGG + Intergenic
970125707 4:12807499-12807521 CACTTTTTAATGGGATTATTTGG + Intergenic
970259357 4:14207928-14207950 CACTTTTTGATGGGGTTGTTTGG + Intergenic
970516822 4:16840087-16840109 TCCTTCCTGATAGGATTGTTGGG - Intronic
970750303 4:19352157-19352179 CACCTTCTGCTATGATTGTAAGG - Intergenic
970911002 4:21275568-21275590 GGCTTTCTCATAGGAGTGTTGGG - Intronic
971529813 4:27672676-27672698 CACTGAAAGATAGGATTGTTTGG - Intergenic
971970269 4:33610543-33610565 CACTTTTTAATGGGGTTGTTTGG - Intergenic
972266020 4:37460664-37460686 CACTTTTTGATGGAGTTGTTTGG + Intronic
972428656 4:38959495-38959517 CACTTTCTGCCATGATTGTTAGG + Intergenic
972453909 4:39233079-39233101 TCCTATCTCATAGGATTGTTGGG - Intronic
973011012 4:45073142-45073164 CACTTTCTGCCATGATTGTAAGG - Intergenic
973075221 4:45916691-45916713 CACTTTTTGGTGGGGTTGTTTGG - Intergenic
973123093 4:46547096-46547118 CACTTTCTAATGAGGTTGTTTGG + Intergenic
973231694 4:47846221-47846243 CACTTTTTGATGGGGTTGTTTGG - Intergenic
973244628 4:47997880-47997902 CAATTTATGATAGGTTTATTGGG - Intronic
973731246 4:53824462-53824484 CACTTTTTGATGGGGTTGTTTGG + Intronic
973971920 4:56221695-56221717 CACTTTTTCATGGGATTATTTGG - Intronic
974135816 4:57816468-57816490 CATTTTCTAATTGCATTGTTTGG - Intergenic
974261409 4:59529878-59529900 CACTTTTTGATGGGGTTGTTTGG + Intergenic
974264253 4:59563840-59563862 CACTTTCTGTCATGATTGTGAGG + Intergenic
974322353 4:60368185-60368207 CACCTTCTGCTATGATTGTGAGG + Intergenic
974496525 4:62635490-62635512 CATTTTTTGATGGGGTTGTTTGG - Intergenic
974758699 4:66247442-66247464 CACTTTCTGCAATGATTGTGAGG + Intergenic
974857831 4:67482076-67482098 CACTTTTTGATGAGATTGTTTGG - Intronic
975203875 4:71622815-71622837 CACTTTCTGCCATGATTGTGAGG - Intergenic
975371762 4:73597285-73597307 CACTTTTTAATGGGGTTGTTTGG - Intronic
975755782 4:77570419-77570441 CACTTTTTAGTGGGATTGTTTGG - Intronic
975884318 4:78946028-78946050 CATTTTTTAATTGGATTGTTTGG + Intergenic
975905414 4:79205439-79205461 CCCTTTTTAATAGGATTATTTGG + Intergenic
975917830 4:79346298-79346320 CACTTTCTGCCATGATTGTGAGG + Intergenic
976678276 4:87726619-87726641 CACTGTCTGCTATGATTGTGAGG + Intergenic
976760534 4:88544231-88544253 CACTTTTTGAAGGGGTTGTTTGG - Intronic
976910854 4:90303962-90303984 CACTTTTTGATGGGGTTGTTTGG - Intronic
977079758 4:92510201-92510223 AACTTTCTGATAGGTTGATTTGG + Intronic
977125720 4:93165062-93165084 AACTTCCTCATAGGATTGTTGGG + Intronic
977404335 4:96576723-96576745 CACTTTTTGATGGGGTTTTTTGG + Intergenic
977417402 4:96750331-96750353 CACTTTCTGCCATGATTGTAAGG - Intergenic
977497007 4:97789176-97789198 ACCTTTCTCATAGGATAGTTGGG + Intronic
977560047 4:98523201-98523223 CCTTTTCTGTTAGAATTGTTTGG + Intronic
977948579 4:102942988-102943010 CACTTTTTGATAGGATAATTTGG - Intronic
978025150 4:103864293-103864315 CACTTTTTTATGGGGTTGTTTGG + Intergenic
978113810 4:104994597-104994619 CACTTTTTGATGGGATTGTTTGG + Intergenic
978492166 4:109320966-109320988 CACTTTTTAATGGGGTTGTTTGG + Intergenic
978551695 4:109934391-109934413 CACTTTTTTATGGGGTTGTTTGG + Intronic
978782624 4:112572714-112572736 CACTTTTTGATGGGATCATTTGG - Intronic
979105395 4:116680569-116680591 CACTTTTTAATGGGGTTGTTTGG - Intergenic
979112356 4:116775874-116775896 CACTTTTTGATGGGGTTTTTTGG + Intergenic
979672518 4:123375069-123375091 CACTTTCTAATTGGATTGTTTGG + Intergenic
979973290 4:127164423-127164445 CACTTTCTGATAGATTTTGTGGG - Intergenic
980201068 4:129656805-129656827 TACTTTTTGATGGGGTTGTTTGG - Intergenic
980413392 4:132452860-132452882 CATTTTTTGATTGGATTATTAGG - Intergenic
980598417 4:134987286-134987308 CACCTTCTGCCAGGATTGTGAGG + Intergenic
980762523 4:137254450-137254472 CACTTTTTAATGGGGTTGTTTGG + Intergenic
980837226 4:138210555-138210577 CACTTTTTAATAGGATTATTTGG - Intronic
981181330 4:141749261-141749283 CACTTTTTAATGGGATTATTTGG - Intergenic
981327984 4:143474010-143474032 CAGTTTCTGTTAGAATTTTTTGG + Exonic
981351056 4:143730149-143730171 CACCTTCTGTTATGATTGTCAGG - Intergenic
981353306 4:143757322-143757344 CACTTTTTGATGGGGTTGTTTGG - Intergenic
981512337 4:145571631-145571653 CACTTTTTAATGGGGTTGTTTGG - Intergenic
982019522 4:151189669-151189691 CACCTTCTGCTATGATTGTGAGG + Intronic
982189323 4:152837608-152837630 TACTTTTTGATGGGATTATTTGG + Intronic
982219307 4:153111231-153111253 CTCTCTCTGATAGGAGTATTTGG - Intergenic
982674797 4:158363390-158363412 CACTTTTTGATGGGTTTGTTTGG + Intronic
982679675 4:158413973-158413995 CACTTTTTGATGGGATTGTTTGG + Intronic
983233920 4:165157571-165157593 CATTTTTTGATGGGATTATTCGG - Intronic
983263563 4:165483797-165483819 CACTTTTTAATGGGGTTGTTGGG + Intronic
983442655 4:167807150-167807172 CACTTTCTGATAGGTTTGAATGG - Intergenic
983706412 4:170665521-170665543 CACTTGTTGATGGGGTTGTTTGG - Intergenic
983845201 4:172509279-172509301 CACTTTTTGATGGGATTCTTTGG + Intronic
984213321 4:176877310-176877332 CACTTTCTGCCATGATTGTGAGG - Intergenic
984253294 4:177360388-177360410 CACTTTTTGATAGAATTTCTTGG + Intronic
984851780 4:184160478-184160500 CATTTTTTGATGGGATTATTTGG + Intronic
985416123 4:189737312-189737334 CACTTTCTGCCATGATTGTGAGG + Intergenic
986108687 5:4688359-4688381 CACTTTTTGATGGGGTTGTTTGG - Intergenic
986537771 5:8809544-8809566 CAGTTTTTGATGGGATTATTTGG + Intergenic
986950319 5:13074969-13074991 CACTTTTTGATGGGGTTGTTTGG + Intergenic
987091756 5:14513861-14513883 CATTTTCTTGTTGGATTGTTTGG + Intronic
987351868 5:17029539-17029561 CACTTTTTAATGGGATTGTTGGG - Intergenic
987527801 5:19076275-19076297 CACTTTTTAATGGGATTGTTTGG - Intergenic
987799388 5:22674383-22674405 CACTTTCTGCCATGATTGTGAGG + Intronic
988385546 5:30559894-30559916 CACTTTTTGACAGGATTGTTTGG + Intergenic
988462986 5:31458160-31458182 CAGTTTATGATAGGTTTATTGGG - Intronic
988639785 5:33028992-33029014 CACTTTTTTATGAGATTGTTTGG - Intergenic
988929299 5:36020262-36020284 CACTTTTTGGTGGGATTGTTTGG + Intergenic
989234465 5:39129619-39129641 CACCTTTTTATGGGATTGTTTGG - Intronic
989364721 5:40642912-40642934 CACTTTTTGATGGGGTTGTTTGG + Intergenic
989447764 5:41550903-41550925 CATTTTTTAATAGGGTTGTTTGG - Intergenic
989460307 5:41690228-41690250 CACTTTTTAATGGGGTTGTTTGG + Intergenic
989697626 5:44222131-44222153 CACTTTTTGATGGGGTTGTTTGG - Intergenic
990167696 5:53012929-53012951 CACTTTTTAATGGGGTTGTTTGG + Intronic
990477581 5:56175929-56175951 CTCTATCTTAGAGGATTGTTAGG + Intronic
990642302 5:57800528-57800550 CATTTTTTAATGGGATTGTTTGG + Intergenic
990769969 5:59232341-59232363 CACTTTTTGATGGGATTATTTGG - Intronic
990858467 5:60299129-60299151 AACCTTCTGATAGGAATTTTAGG + Intronic
990871942 5:60441749-60441771 CTCTTTTTGATGGGGTTGTTTGG - Intronic
991277967 5:64873515-64873537 CATTTTCAAATAGGATTATTGGG + Intronic
991496395 5:67230448-67230470 TACTTTCTGCTAGAATTGTGAGG + Intergenic
992458826 5:76941479-76941501 CACTTTCTGCCATGATTGTGAGG + Intergenic
992702763 5:79357673-79357695 CACTCTCTGATAGGATTTATAGG - Intergenic
992767157 5:80011954-80011976 CACTTTCTGTTAGTGTTGCTTGG + Intronic
992899729 5:81281944-81281966 CACTTTTTGATGGGGTTGTTTGG - Intergenic
993139063 5:84007434-84007456 CATTTTCTGATCAGATTATTAGG - Intronic
993293963 5:86110099-86110121 CACTTTCTGCCATGATTGTGAGG + Intergenic
993364306 5:87018161-87018183 CACTTTTTAATGGGATTGTTTGG + Intergenic
993433402 5:87860678-87860700 CACTTTTTGATGGGATCATTTGG + Intergenic
993465715 5:88243962-88243984 CACTTTTTGATTGGGTTGTCTGG + Intronic
993697149 5:91075015-91075037 CACTTTTTAATGGGCTTGTTTGG + Intronic
994000050 5:94768546-94768568 CACTTTTTAATTGGATTATTTGG - Intronic
994480458 5:100327772-100327794 CACTTCTTGATGGGATTTTTGGG + Intergenic
994500873 5:100575845-100575867 CACTTTTTGATGGGGTTGTTTGG - Intronic
994878275 5:105452200-105452222 CACCTTCTGCTATGATTGTGAGG + Intergenic
995157087 5:108928322-108928344 TACTTTCTGATGGAATTCTTAGG + Intronic
995188473 5:109296088-109296110 CACTTTTTAATGGGATTGTTAGG - Intergenic
995295046 5:110510605-110510627 CACCTTTTGATAGGGTTGTTTGG - Intronic
995489367 5:112674323-112674345 CACCTTTTGATGGGGTTGTTTGG + Intergenic
995688438 5:114796987-114797009 CACTTGTTGATGGGGTTGTTTGG + Intergenic
995834196 5:116384119-116384141 CACCTTCTGACATGATTGTGAGG + Intronic
996199309 5:120651158-120651180 CACTTTTTGATGGGGTTGTTTGG + Intronic
996277102 5:121680401-121680423 CACTTTTTTATGGGGTTGTTTGG - Intergenic
996484682 5:124018036-124018058 CACTTTTTGATGGGGTTGTTTGG + Intergenic
996515369 5:124363548-124363570 CACTTTTTGATGGGGTTGTTTGG - Intergenic
996694580 5:126379737-126379759 CACTTTTTGATGGGATTGTTTGG + Intronic
997105553 5:131015129-131015151 CACTTTTTGATGGGATTGTTTGG + Intergenic
998294552 5:140954601-140954623 CACTTTTTAATGGGCTTGTTTGG + Intronic
998776117 5:145605002-145605024 CACTTTTTAATGGGGTTGTTTGG + Intronic
999032641 5:148311305-148311327 CACTTTCTGCCATGATTGTGAGG - Intergenic
999057093 5:148589528-148589550 CATTTTCTGGTTGGGTTGTTTGG + Intronic
999189593 5:149737191-149737213 CACTTGCTGATAGGAATTTAAGG + Intronic
999343428 5:150793981-150794003 CACTTTTTGATGGGATTCTTTGG - Intronic
999346756 5:150829428-150829450 CACTTTTTAATAGGGTTGTTTGG - Intergenic
999473566 5:151877779-151877801 CACTTTCTGCCATGATTGTGAGG + Intronic
999513957 5:152281603-152281625 CACTTTCTGCCATGATTGTGAGG + Intergenic
999867294 5:155714774-155714796 CACTTGTTGATGGGGTTGTTTGG + Intergenic
1000654023 5:163854251-163854273 CACTTTTTGATGGGGTTGTTGGG - Intergenic
1000673281 5:164089054-164089076 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1000868678 5:166547736-166547758 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1001848970 5:174946412-174946434 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1002825502 6:769487-769509 CACGTTTTGATGGGATTGTTTGG - Intergenic
1002880708 6:1249646-1249668 CACTTTTTAATGGGATTGTTTGG + Intergenic
1003151663 6:3557308-3557330 TACTTTCTAATTGGGTTGTTTGG - Intergenic
1003443406 6:6164123-6164145 CACTTTTTAATGGGGTTGTTTGG - Intronic
1003738909 6:8912031-8912053 CATTTTTTGATTGGATTATTAGG - Intergenic
1003739491 6:8919914-8919936 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1004096973 6:12565924-12565946 CACATTTTGATGGGATTATTTGG - Intergenic
1004600200 6:17142409-17142431 CACTTTTTGATGGGACTGTTTGG + Intergenic
1005107761 6:22243801-22243823 CACTTTTTGATGGGATTGTGGGG - Intergenic
1005394926 6:25371590-25371612 CACTTTTTGATGGGATTATTTGG + Intronic
1005920767 6:30398563-30398585 CACTTTTTAATAGAATTTTTTGG + Intergenic
1006063553 6:31443396-31443418 CACTTTTTAATAAGATTGTTTGG + Intergenic
1006475828 6:34253002-34253024 TACTTTTTGATGAGATTGTTTGG - Intergenic
1008095951 6:47339554-47339576 CACTTTTTGATGGGATTGTTTGG - Intergenic
1008154895 6:48001920-48001942 CACTTGTTGATGGGGTTGTTTGG - Intronic
1008202546 6:48609317-48609339 CACTTTTTGATCGGATTATTGGG + Intergenic
1008634019 6:53391318-53391340 CACTTTCAGTTAGGAGTATTTGG + Intergenic
1008643773 6:53491936-53491958 CAGTTTTTGATGGGGTTGTTTGG + Intergenic
1008689825 6:53965454-53965476 CACGTTCTGCCATGATTGTTAGG + Intronic
1009194509 6:60667899-60667921 CACCTTCTGACATGATTGTGAGG - Intergenic
1009673997 6:66793287-66793309 TACTTTTTAATAGGATTATTTGG - Intergenic
1009729202 6:67578307-67578329 CACTTTCTGCCATGATTGTGAGG + Intergenic
1009772359 6:68160169-68160191 CACTTTCTGCTGTGATTGTGAGG + Intergenic
1010401215 6:75448652-75448674 CACTTTTTGATGGGATTGTTTGG - Intronic
1010880214 6:81158426-81158448 CACTTTTTGATGAGATTATTTGG - Intergenic
1010944944 6:81962813-81962835 CATTTTCTGATCAGACTGTTGGG - Intergenic
1011071076 6:83384475-83384497 CACTTTTTAATGGGATTGTTTGG + Intronic
1011196718 6:84788125-84788147 CACTTTGTGATATGATTGTTTGG + Intergenic
1011211363 6:84959555-84959577 CACCTTCTGCTATGATTGTGAGG + Intergenic
1011229685 6:85146431-85146453 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1011415015 6:87109412-87109434 CACCTTCTGTTATGATTGTGAGG + Intergenic
1011803762 6:91047976-91047998 CACTTGTTGATGGGGTTGTTTGG + Intergenic
1012343029 6:98152288-98152310 CACTTTTTGATGGAGTTGTTTGG + Intergenic
1012483309 6:99691833-99691855 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1012484639 6:99707269-99707291 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1012681674 6:102190535-102190557 GACTTTGTGATAGGTTTCTTGGG + Intergenic
1012738250 6:102978651-102978673 CACTTTTTGATGGAATTGTTGGG - Intergenic
1012756547 6:103239488-103239510 CACTTTCTGCCATGATTGTAAGG + Intergenic
1013115154 6:107097817-107097839 CACTGAGTGATAGGTTTGTTGGG - Intronic
1013462040 6:110384088-110384110 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1014028716 6:116677805-116677827 AACTTACTGATGGGTTTGTTGGG + Intergenic
1014095859 6:117460418-117460440 CATTTTCTAATGGGATTGCTCGG + Intronic
1014359068 6:120452586-120452608 CACTTCTTAATGGGATTGTTTGG - Intergenic
1014516291 6:122382698-122382720 CACTTTTTAATGGGTTTGTTTGG + Intergenic
1014700719 6:124684384-124684406 CAGTTTCTGATAGGAGTCTGGGG - Intronic
1014830456 6:126097156-126097178 AGTTTTCTGATAGTATTGTTAGG + Intergenic
1014853458 6:126369607-126369629 CACTTTTTGTTGGGATTGTTTGG + Intergenic
1015047562 6:128794629-128794651 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1015268505 6:131314527-131314549 CATTTTTTGATAGGATTGTTTGG + Intergenic
1015415860 6:132947754-132947776 CACTTTCTCAATGGATTCTTTGG - Intergenic
1015672280 6:135704176-135704198 CAATTTCAGATAGGATAGTCAGG - Intergenic
1015877523 6:137838165-137838187 CACTTTTTGATAGGCTTGTTTGG + Intergenic
1016188306 6:141226257-141226279 CACTTTCTGCCATGATTGTGAGG - Intergenic
1016590705 6:145740370-145740392 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1017305141 6:152909510-152909532 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1017330204 6:153188560-153188582 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1017330752 6:153195838-153195860 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1017944425 6:159082241-159082263 CATTTTTTGATGGGATTGTTTGG - Intergenic
1018212117 6:161491990-161492012 ACCTTCCTCATAGGATTGTTGGG + Intronic
1018515265 6:164572440-164572462 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1018602482 6:165559895-165559917 CACCTTCTGCTATGATTGTGAGG + Intronic
1020425732 7:8063934-8063956 CACTTTTTAATGGGATTCTTTGG + Intronic
1020582486 7:10021577-10021599 CACTTTATGATGGCATGGTTTGG + Intergenic
1020754919 7:12190278-12190300 CACCTTCTGCCAGGATTGTGAGG - Intergenic
1020780438 7:12510723-12510745 CACTTTTTAATAGGATTGTTTGG + Intergenic
1021084717 7:16408611-16408633 CACATTCTAATAGGAGTTTTTGG + Intronic
1021309636 7:19077926-19077948 CACTTTTTAATGGGATTGTTTGG - Intronic
1021321540 7:19218759-19218781 CACATTTTGATGGGGTTGTTTGG - Intergenic
1021407633 7:20291556-20291578 CACTTTCTCTCAGGATTGGTTGG - Intergenic
1021418413 7:20417009-20417031 CACCTTCTGCTATGATTGTGAGG + Intergenic
1021779477 7:24088526-24088548 CACTTTTTGATGGGATTGTTTGG + Intergenic
1022061711 7:26803281-26803303 TATTTTTTGATTGGATTGTTAGG - Intronic
1022540341 7:31129027-31129049 CACTTCCTGTTTGCATTGTTCGG + Intergenic
1022758411 7:33319870-33319892 CACTTTTTGATAGGATAGTTTGG - Intronic
1023053243 7:36271440-36271462 CACTTTTTGATGGGGTTGTTTGG + Intronic
1023186188 7:37535782-37535804 CAGTTTCTGTCAGTATTGTTGGG + Intergenic
1023273085 7:38487834-38487856 CACTTTTTGATGGGGTCGTTTGG - Intronic
1023472179 7:40535521-40535543 CACTCACTAATAGGATTGCTGGG - Intronic
1023537489 7:41228839-41228861 CACTTTTTGATGGGATTGTTTGG + Intergenic
1023748319 7:43344087-43344109 CACTTTTTGATGGGGTTGTTTGG + Intronic
1023859835 7:44211982-44212004 CACTTTTTGATAGCATTAATGGG + Intronic
1024499650 7:50091144-50091166 CACTTTTTGATGGGACTGTTGGG + Intronic
1024847432 7:53663385-53663407 CACTTTTTGATGGGATTATTTGG + Intergenic
1025582468 7:62737615-62737637 CACTTGTTGATGGGGTTGTTTGG + Intergenic
1027465578 7:78511031-78511053 CACTTTTTAATGGGATTATTGGG - Intronic
1027693253 7:81374496-81374518 CACTTTTTGATGGGATTGTTTGG + Intergenic
1027862748 7:83605775-83605797 CACCTTTTGATAGGGTTGTTTGG + Intronic
1028182595 7:87743644-87743666 CACTTTTTGATGGGATTGTTTGG + Intronic
1028644630 7:93081691-93081713 CATTTTTTGATGGGGTTGTTTGG - Intergenic
1028669132 7:93381185-93381207 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1028776731 7:94685580-94685602 CACTTTCTCATACTATTGTTGGG - Intergenic
1029019541 7:97349925-97349947 CCATTTCTAATTGGATTGTTTGG - Intergenic
1029462164 7:100701545-100701567 CATTTTCTAATTGGGTTGTTCGG + Intergenic
1029853222 7:103486567-103486589 CACTTTTTGATGGGGTTGTTTGG - Intronic
1029955718 7:104637210-104637232 CACTTTTTAATGGGGTTGTTTGG + Intronic
1030021844 7:105282953-105282975 CACTTTATCATTGGGTTGTTGGG - Intronic
1030454462 7:109755647-109755669 CACTTTTTAATAGGGTTGTTTGG + Intergenic
1030483970 7:110142118-110142140 CACTTGTTGATGGGGTTGTTTGG - Intergenic
1030562616 7:111109677-111109699 CACATGCTGACAGGATTATTAGG + Intronic
1030781232 7:113602882-113602904 CACTTTTTGATGGGATTGTTTGG - Intergenic
1030788313 7:113690777-113690799 TAGTTTTTGATAGGATTGTTTGG - Intergenic
1031023935 7:116659941-116659963 CACTTTTTAATGGAATTGTTGGG + Intergenic
1031086366 7:117305294-117305316 TACTTTCTGAGAGGTTTATTTGG + Intronic
1031265518 7:119574738-119574760 CACTTTTTGATAGAGTTATTTGG + Intergenic
1031499639 7:122497859-122497881 AAATTACTGATAGGATTGCTGGG - Intronic
1031641702 7:124172530-124172552 CACTTTTTGATGGGGTTTTTTGG + Intergenic
1031663925 7:124461549-124461571 CACTTTTTAATGGGGTTGTTAGG + Intergenic
1031709691 7:125030265-125030287 CACTTTTTGATGGGGTTCTTTGG + Intergenic
1032535840 7:132662973-132662995 CACTTTTTGATGGGGTTGTTTGG + Intronic
1032537208 7:132674229-132674251 CACTTTTTGATGGGGTTGTTTGG + Intronic
1032902357 7:136324017-136324039 CACTTTCTGCCATGATTGTGAGG - Intergenic
1032978403 7:137252365-137252387 CACTTTCTTATTGAACTGTTAGG + Intronic
1033721371 7:144062289-144062311 CACTTTCTGCCATGATTGTGAGG + Intergenic
1033835760 7:145309924-145309946 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1034018825 7:147617712-147617734 CACTATCTCTTAGTATTGTTTGG + Intronic
1034397320 7:150836985-150837007 GCCTTTCTCAGAGGATTGTTGGG + Intronic
1034751213 7:153570593-153570615 CACTTTCTGCCATGATTGTGAGG + Intergenic
1035696036 8:1596703-1596725 CACTTTATGATTGGGTTGTTAGG + Intronic
1035830278 8:2688089-2688111 CAGTTTCTGCTAGGATTATTTGG + Intergenic
1036394489 8:8357343-8357365 CAGTTTTTAATTGGATTGTTTGG - Intronic
1037737045 8:21576302-21576324 AACTTTCTCATAGGGTTATTGGG - Intergenic
1038119829 8:24600730-24600752 AAATTTCTGAGAGGATTGCTAGG - Intergenic
1038237502 8:25774342-25774364 CACTTTTTGATGGGATTGTTTGG - Intergenic
1038295742 8:26290144-26290166 TCCTACCTGATAGGATTGTTGGG - Intergenic
1038521825 8:28239976-28239998 CATTTTCTAATTGGATTGCTTGG - Intergenic
1039145649 8:34443657-34443679 CATTTTTTGATGGGGTTGTTTGG - Intergenic
1040541307 8:48359276-48359298 CATTTTCTAATTGGATTGTTTGG - Intergenic
1040651356 8:49452273-49452295 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1041214262 8:55584246-55584268 CAATTTTTAATAGGATTGTTTGG - Intergenic
1041462471 8:58126729-58126751 CATTTTCCAATTGGATTGTTTGG + Intronic
1041611828 8:59859339-59859361 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1041837958 8:62238348-62238370 CACTTTTTGATGAGGTTGTTTGG + Intergenic
1041870004 8:62622602-62622624 CATTTTCTAATTGGATTATTTGG + Intronic
1041937439 8:63349429-63349451 CACTTTTTGATGGGATTATTTGG + Intergenic
1042465232 8:69122006-69122028 CACTTTTTGATGGGATTATTTGG + Intergenic
1042725662 8:71873506-71873528 AAATTTCTGTTAGGTTTGTTTGG + Intronic
1042984713 8:74570332-74570354 CACTTTCTGCCATGATTGTGAGG - Intergenic
1042995928 8:74698668-74698690 CACCTTTTCATGGGATTGTTTGG - Intronic
1043822359 8:84883444-84883466 CACTTTCTGCTATGACTGTGAGG - Intronic
1043869808 8:85419675-85419697 CACTTGTTGATGGGGTTGTTTGG + Intronic
1043890844 8:85651234-85651256 CACTTGTTGATGGGGTTGTTTGG + Intergenic
1043893645 8:85719269-85719291 CACTTGTTGATGGGGTTGTTTGG - Intergenic
1043896324 8:85740718-85740740 CACTTGTTGATGGGGTTGTTTGG - Intergenic
1043898677 8:85759457-85759479 CACTTGTTGATGGGGTTGTTTGG + Intergenic
1043900291 8:85771651-85771673 CACTTGTTGATGGGGTTGTTTGG + Intergenic
1043902252 8:85786926-85786948 CACTTGTTGATGGGGTTGTTTGG + Intergenic
1043903861 8:85799119-85799141 CACTTGTTGATGGGGTTGTTTGG + Intergenic
1043905473 8:85811313-85811335 CACTTGTTGATGGGGTTGTTTGG + Intergenic
1043907082 8:85823500-85823522 CACTTGTTGATGGGGTTGTTTGG + Intergenic
1044154512 8:88826927-88826949 CACTTTTTGATGGAGTTGTTTGG + Intergenic
1044377663 8:91495206-91495228 CACATTTTGATGGGGTTGTTTGG + Intergenic
1044716760 8:95106794-95106816 CACTTTTTGATGGGGTTGTTTGG - Intronic
1044876968 8:96678734-96678756 CACTTTTTAATGGGATTATTTGG + Intronic
1044887307 8:96793328-96793350 CACTTTCTGCCACGATTGTGAGG - Intronic
1044961527 8:97535884-97535906 CACTTTTTGATAGGGTTGTTTGG - Intergenic
1045184692 8:99825404-99825426 CACTTTCTGATGGGGTTGGTTGG + Intronic
1045370511 8:101517825-101517847 GACTTTCTAACAGGATTGCTTGG + Intronic
1045464452 8:102456814-102456836 CACTTACTGCTTGGTTTGTTAGG + Intergenic
1045891376 8:107162160-107162182 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1045978324 8:108154620-108154642 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1046169134 8:110482271-110482293 GACTTTATGATAGGTTTATTGGG + Intergenic
1046360177 8:113143127-113143149 CATTTTCAAATTGGATTGTTTGG - Intronic
1046485987 8:114889300-114889322 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1046730619 8:117721929-117721951 CACTTTTTAATGGGATTATTTGG + Intergenic
1046779484 8:118200126-118200148 CACCTTCTGCTATGATTGTGAGG + Intronic
1046810738 8:118530516-118530538 CACTTTTTAATAGGGTTATTTGG + Intronic
1047550426 8:125866354-125866376 GACTTTATGATAGGTTTATTGGG + Intergenic
1047939076 8:129810255-129810277 CACTTTGTAATGGGATTATTTGG + Intergenic
1048157076 8:131966569-131966591 CAATTACTCATAGGATTCTTGGG - Intronic
1049085484 8:140475127-140475149 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1050156138 9:2667935-2667957 TACCTTCTGATATGATTGTGAGG + Intergenic
1050157328 9:2681265-2681287 CTCTTTCTTATAGGTTTGATGGG - Intergenic
1050176474 9:2874239-2874261 CTCTTTCTTAGAGGATTGTGAGG - Intergenic
1050411230 9:5367899-5367921 CACTTTTTAATGGGATTATTTGG - Intronic
1050701267 9:8342005-8342027 GATTTTCTGATAGGTTTATTTGG - Intronic
1050974915 9:11925753-11925775 CACTTTATAATGGGGTTGTTTGG - Intergenic
1051023464 9:12574926-12574948 CACTTTTTGATAGCAGTGATAGG + Intergenic
1051341473 9:16115933-16115955 CACCTTCTGCCAGGATTGTCAGG - Intergenic
1051357080 9:16249476-16249498 CCCTATCTCATAGGACTGTTGGG + Intronic
1051836725 9:21346787-21346809 CACTTTGTGACAGGGTTGTTTGG - Intergenic
1052107303 9:24535053-24535075 CACTTTTTGGTGGGATTATTTGG + Intergenic
1052200209 9:25769184-25769206 CACTTTTTGGTGGGGTTGTTTGG - Intergenic
1052203486 9:25810282-25810304 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1052335771 9:27318515-27318537 CACTTTTTGATGGCGTTGTTTGG + Intergenic
1052599379 9:30604816-30604838 CACTTTCTGATATCAAAGTTGGG + Intergenic
1052697693 9:31899236-31899258 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1053555125 9:39129797-39129819 CATTTTCTAATTGGATTGTTTGG - Intronic
1053750989 9:41254601-41254623 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1053819243 9:41950043-41950065 CATTTTCTAATTGGATTGTTTGG - Intronic
1054109509 9:61093703-61093725 CATTTTCTAATTGGATTGTTTGG - Intergenic
1054256504 9:62818938-62818960 CAGTTTTTGATGGGGTTGTTTGG + Intergenic
1054334803 9:63796681-63796703 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1054347816 9:63984980-63985002 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1054445540 9:65311324-65311346 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1054484729 9:65710184-65710206 CACTTTTTGATGGGGTTGTTTGG + Intronic
1054611348 9:67237422-67237444 CATTTTCTAATTGGATTGTTTGG + Intergenic
1054819876 9:69511233-69511255 CACTTTTTGATGGGGTTGTTTGG - Intronic
1055275121 9:74606752-74606774 TTCTTTCTGACAGGATTGTTGGG + Intronic
1055519598 9:77067247-77067269 CACCTTCTGCTATGATTGTGAGG + Intergenic
1055821617 9:80271592-80271614 CACTTTCTGCCATGATTGTGAGG - Intergenic
1056249671 9:84734731-84734753 CACTTTCTGCCATGATTGTGAGG + Intronic
1056255193 9:84791706-84791728 CTCTTTCTGATTGGATTTTATGG + Intronic
1056347980 9:85718499-85718521 CACTTTTTGATGGGGTTGTTTGG + Intronic
1057281441 9:93714735-93714757 CATTTTCTAATTGGTTTGTTGGG + Intergenic
1057284111 9:93735006-93735028 CATTTTTTAATAGGGTTGTTTGG - Intergenic
1057519089 9:95746760-95746782 CAATTTATGATGGGATTGCTGGG - Intergenic
1057697157 9:97331732-97331754 CACTTTTGAATAGGGTTGTTTGG + Intronic
1058500656 9:105612207-105612229 CACTTTTTAATGGGGTTGTTTGG + Intronic
1058579377 9:106438432-106438454 CACTTTCAGAAAGGAATTTTGGG + Intergenic
1058616457 9:106834031-106834053 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1059651569 9:116320384-116320406 CACTTTCTGATAAGATAACTTGG - Intronic
1059699114 9:116758113-116758135 CACTTCTTTATTGGATTGTTTGG + Intronic
1060020255 9:120124085-120124107 CACTTTTTGATGGGGTTGTTGGG - Intergenic
1061752254 9:132787535-132787557 CACTTTCAGATAGAATAGTAGGG + Intronic
1203385241 Un_KI270438v1:44538-44560 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1203636940 Un_KI270750v1:121728-121750 CACTTTCTGCCATGATTGTGAGG - Intergenic
1185673542 X:1830681-1830703 CACTTTCTGCCATGATTGTGAGG - Intergenic
1185988127 X:4859610-4859632 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1186021806 X:5264588-5264610 CACTTTCTGCCATGATTGTGAGG - Intergenic
1186531697 X:10303161-10303183 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1186593690 X:10958230-10958252 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1186755166 X:12663032-12663054 CATTTTTTGATAGGGTTGTTTGG + Intronic
1186813154 X:13209681-13209703 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1186941519 X:14513575-14513597 CACTTTTTGATGGGATTGTTCGG - Intergenic
1186949131 X:14603256-14603278 CACTTTTTGATGGGATTGTTTGG + Intronic
1187282702 X:17871406-17871428 CATTTTATGATTGGATTGTTTGG + Intergenic
1187607382 X:20900592-20900614 CACTTTTTAATGGGGTTGTTGGG + Intergenic
1187695715 X:21917763-21917785 CACTTTTTGATGAAATTGTTTGG + Intergenic
1187704922 X:22000274-22000296 CACCTTTTGATGGGCTTGTTTGG + Intergenic
1188139261 X:26528165-26528187 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1188792753 X:34424302-34424324 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1189253592 X:39620316-39620338 CACTTTCTGCCATGATTGTGAGG - Intergenic
1189552090 X:42103598-42103620 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1189559043 X:42173816-42173838 CACTTTTTGATGGGGCTGTTCGG + Intergenic
1189649942 X:43177920-43177942 CACTTTCTGCCATGATTGTAAGG + Intergenic
1189943074 X:46147121-46147143 CATTTTCTAATTGGATTCTTTGG + Intergenic
1190544663 X:51513149-51513171 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1190552110 X:51594831-51594853 CACTTTTTAATGGAATTGTTTGG + Intergenic
1191012979 X:55780134-55780156 CACTTTTTGATGGGATTGTTTGG - Intergenic
1191023332 X:55886530-55886552 CACTTTTTGATGGGGTTGTGTGG + Intergenic
1191230938 X:58093727-58093749 CACTTGTTGATGGGGTTGTTTGG - Intergenic
1191602804 X:63028018-63028040 CACCTTCTGCTATGATTGTGAGG - Intergenic
1191692520 X:63955400-63955422 CACTTTTTGATGGGATTGTTTGG - Intergenic
1191749465 X:64526319-64526341 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1191876413 X:65801783-65801805 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1191924242 X:66292074-66292096 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1191936043 X:66428225-66428247 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1191939164 X:66459142-66459164 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1192063809 X:67859927-67859949 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1192075430 X:67990695-67990717 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1192508258 X:71704271-71704293 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1192512414 X:71730633-71730655 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1192514283 X:71750876-71750898 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1192518438 X:71777282-71777304 CACTTTTTAATGGGGTTGTTTGG - Intergenic
1192628094 X:72750982-72751004 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1192653615 X:72969826-72969848 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1192684202 X:73286656-73286678 CACTTGTTGATGGGGTTGTTTGG - Intergenic
1192820672 X:74641982-74642004 CACTTTTTGATGGGATTGTTTGG - Intergenic
1192851537 X:74961632-74961654 CACTTTTTGATGTGGTTGTTTGG - Intergenic
1192865596 X:75128756-75128778 CACTTTTTGATGGGGTTATTTGG - Intronic
1192886720 X:75342908-75342930 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1192893918 X:75420115-75420137 CACTTTTTGATGGGGTTGTTTGG - Intronic
1192957632 X:76090072-76090094 CACTTTTCGATGGGATTGTTTGG + Intergenic
1192961323 X:76134171-76134193 CACTTTTTGATGGGATTATTTGG - Intergenic
1192964665 X:76164641-76164663 CACTTTTTGATAAGGTTGTTTGG - Intergenic
1193035295 X:76943826-76943848 CACTTTTTAAAGGGATTGTTTGG + Intergenic
1193057243 X:77166398-77166420 CACTTTTTGATGGGATTATTTGG + Intergenic
1193102080 X:77625556-77625578 CACTTTGTGGTAAGATTGTTTGG - Intronic
1193217392 X:78880192-78880214 CACTTTCTAATGGGGTTGTTTGG - Intergenic
1193226582 X:78990681-78990703 CACCTTCTGACATGATTGTGAGG + Intergenic
1193265978 X:79470011-79470033 CATTTTTTCATAGGTTTGTTGGG - Intergenic
1193340848 X:80347501-80347523 CACTTTTTGATGGGGTTGTTTGG + Intronic
1193425057 X:81332258-81332280 CACCTTTTAATAGGGTTGTTTGG + Intergenic
1193492655 X:82168235-82168257 CACCTTCTGCTATGATTGTGAGG - Intergenic
1193870596 X:86793194-86793216 CACTTTATAATGGGATTATTAGG + Intronic
1193913447 X:87334626-87334648 CACTTTTTAATGGGATTATTTGG + Intergenic
1194037977 X:88902509-88902531 CACTTTTTCATGGGATTATTTGG - Intergenic
1194041788 X:88950554-88950576 CATTTTCTAATTGGATTGTTTGG + Intergenic
1194287263 X:92025291-92025313 CACTTTTTGATGGGGTTGTTTGG - Intronic
1194331131 X:92583752-92583774 CACTTTTTGACATGATTGTGAGG + Intronic
1194376104 X:93135829-93135851 CACTTTTTGATGGGGCTGTTTGG - Intergenic
1194548652 X:95269861-95269883 CACTTTCTGCCATGATTGTGAGG - Intergenic
1194617255 X:96120744-96120766 CACTTTTTGCTGGGGTTGTTTGG + Intergenic
1194637816 X:96366975-96366997 CACTTTTTGATGGGATTGTTTGG + Intergenic
1194735298 X:97505875-97505897 CAGATTCTAAGAGGATTGTTGGG + Intronic
1194851164 X:98870823-98870845 CACTTTTTAATGGCATTGTTTGG + Intergenic
1195099429 X:101540120-101540142 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1195213649 X:102674976-102674998 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1195408117 X:104539400-104539422 CACTATTTGTTAGTATTGTTAGG + Intergenic
1195579749 X:106487953-106487975 CACTTTTTGATGTGGTTGTTTGG + Intergenic
1195590648 X:106621702-106621724 CAGTTTTTAATAGGATGGTTAGG + Intronic
1195817936 X:108908946-108908968 CACTTTGTGATGGGGTTGTTTGG - Intergenic
1195824532 X:108983777-108983799 TACTTTTTGATGGGATTATTTGG + Intergenic
1196269176 X:113690899-113690921 TATTTCCTGATTGGATTGTTTGG + Intergenic
1196370722 X:114976866-114976888 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1196483502 X:116178894-116178916 CACTTTCTGCCATGATTGTGAGG + Intergenic
1196597750 X:117564863-117564885 CCCTTTCTGATGGGGTTGTTTGG + Intergenic
1196771046 X:119293531-119293553 CATTTTCTGATTGAATTGATTGG + Intergenic
1196947761 X:120844819-120844841 TACTTTTTGATGGGGTTGTTTGG + Intergenic
1197165572 X:123373684-123373706 CACTTTTTGATGGGGTTGTTTGG + Intronic
1197308094 X:124868791-124868813 CATGTTTTGATAGGATTATTAGG - Intronic
1197348654 X:125356515-125356537 CACTTTTTAATGGGACTGTTTGG - Intergenic
1197402777 X:126012258-126012280 CACTTTGTAATGGGGTTGTTTGG - Intergenic
1197560649 X:128016002-128016024 CACCTTCTGCTATGATTGTGAGG - Intergenic
1197589316 X:128389096-128389118 CACTTTTTGATTGGATTGTTTGG - Intergenic
1197683099 X:129407522-129407544 CACTTTTTGATGGGGTTGTTTGG - Intergenic
1197687279 X:129454601-129454623 CACTTTTTAATGGGGTTGTTTGG - Intronic
1197878127 X:131133431-131133453 CACTTTCTGCCATGATTGTGAGG - Intergenic
1197925115 X:131637904-131637926 CACTTTTTGATGGGGCTGTTTGG + Intergenic
1198072766 X:133165752-133165774 CACTTTTTGATAGGGTTGTTTGG - Intergenic
1198076647 X:133199729-133199751 CACTTTTTAATGGGGTTGTTTGG + Intergenic
1198238983 X:134764716-134764738 CTATTTCTGATAGGATAGTGAGG + Intergenic
1198361393 X:135898823-135898845 CACTTTTTAATGGGGTTGTTTGG + Intronic
1198510603 X:137347213-137347235 CACTTTTTGGTGGGATTGTTTGG + Intergenic
1198571768 X:137964981-137965003 CACTTTTTGATGGAGTTGTTTGG - Intergenic
1198575946 X:138010368-138010390 CACTGCCTTATAGGATTATTGGG + Intergenic
1198668661 X:139053582-139053604 CACTTTTTGATGGGACTGTGTGG + Intronic
1198712513 X:139521052-139521074 CACTTTTTAATAGGGTTATTTGG + Intergenic
1198981840 X:142406675-142406697 CACTTTTTGATGGGGTTATTTGG - Intergenic
1199010894 X:142757495-142757517 CACTTTTTGATGGGATTATTTGG + Intergenic
1199793143 X:151173747-151173769 CTCTTTCTAAAAGGCTTGTTAGG - Intergenic
1200328999 X:155274598-155274620 GACTTTATGATGGGTTTGTTGGG + Intergenic
1200333705 X:155324924-155324946 CACTTTTTGATGGGGTTGTTTGG - Intronic
1200564823 Y:4752287-4752309 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1200604800 Y:5249857-5249879 CACTTTTTGATGGGGTTGTTTGG - Intronic
1200819594 Y:7568817-7568839 CACTTTTTGATGGGGTTATTTGG - Intergenic
1200819793 Y:7570883-7570905 CACTTTTTGATGGGGTTGTTTGG + Intergenic
1200870911 Y:8097292-8097314 CACTTGTTGATGGGGTTGTTTGG + Intergenic
1201183965 Y:11379643-11379665 CACTTTTTGATAGGATAATTTGG - Intergenic
1201404751 Y:13638335-13638357 GGCTTTCTGACAGGTTTGTTGGG + Intergenic
1201515124 Y:14812053-14812075 TACTTTCTGCCATGATTGTTAGG - Intronic
1201946933 Y:19520769-19520791 CATTATCTGAAAGGATTATTGGG + Intergenic