ID: 911627492

View in Genome Browser
Species Human (GRCh38)
Location 1:100141573-100141595
Sequence CTTTGGAAGGGTAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195158
Summary {0: 3, 1: 87, 2: 3746, 3: 56082, 4: 135240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911627492 Original CRISPR CTTTGGAAGGGTAAGGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr