ID: 911634772

View in Genome Browser
Species Human (GRCh38)
Location 1:100222744-100222766
Sequence CAGTGAAAGGAGGAGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911634772_911634782 24 Left 911634772 1:100222744-100222766 CCCTCTTTCTCCTCCTTTCACTG No data
Right 911634782 1:100222791-100222813 TCAGTAACTCTCCACTTATCTGG No data
911634772_911634783 27 Left 911634772 1:100222744-100222766 CCCTCTTTCTCCTCCTTTCACTG No data
Right 911634783 1:100222794-100222816 GTAACTCTCCACTTATCTGGTGG No data
911634772_911634784 30 Left 911634772 1:100222744-100222766 CCCTCTTTCTCCTCCTTTCACTG No data
Right 911634784 1:100222797-100222819 ACTCTCCACTTATCTGGTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 125
911634772_911634778 0 Left 911634772 1:100222744-100222766 CCCTCTTTCTCCTCCTTTCACTG No data
Right 911634778 1:100222767-100222789 CCCCATGGTACCTCTCAGTTAGG 0: 1
1: 0
2: 0
3: 8
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911634772 Original CRISPR CAGTGAAAGGAGGAGAAAGA GGG (reversed) Intronic
No off target data available for this crispr