ID: 911638828

View in Genome Browser
Species Human (GRCh38)
Location 1:100266130-100266152
Sequence TCGGCTTAAAGGAGCCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 22}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911638828_911638831 3 Left 911638828 1:100266130-100266152 CCAGCGCGGCTCCTTTAAGCCGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 911638831 1:100266156-100266178 ACGCGCATGCGCACTGACTGCGG 0: 1
1: 0
2: 0
3: 3
4: 22
911638828_911638835 20 Left 911638828 1:100266130-100266152 CCAGCGCGGCTCCTTTAAGCCGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 911638835 1:100266173-100266195 CTGCGGAACTGGGCGAACCCGGG 0: 1
1: 0
2: 0
3: 2
4: 78
911638828_911638833 10 Left 911638828 1:100266130-100266152 CCAGCGCGGCTCCTTTAAGCCGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 911638833 1:100266163-100266185 TGCGCACTGACTGCGGAACTGGG 0: 1
1: 0
2: 1
3: 3
4: 49
911638828_911638832 9 Left 911638828 1:100266130-100266152 CCAGCGCGGCTCCTTTAAGCCGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 911638832 1:100266162-100266184 ATGCGCACTGACTGCGGAACTGG 0: 1
1: 0
2: 0
3: 1
4: 43
911638828_911638837 22 Left 911638828 1:100266130-100266152 CCAGCGCGGCTCCTTTAAGCCGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 911638837 1:100266175-100266197 GCGGAACTGGGCGAACCCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 51
911638828_911638836 21 Left 911638828 1:100266130-100266152 CCAGCGCGGCTCCTTTAAGCCGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 911638836 1:100266174-100266196 TGCGGAACTGGGCGAACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 35
911638828_911638834 19 Left 911638828 1:100266130-100266152 CCAGCGCGGCTCCTTTAAGCCGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 911638834 1:100266172-100266194 ACTGCGGAACTGGGCGAACCCGG 0: 1
1: 0
2: 0
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911638828 Original CRISPR TCGGCTTAAAGGAGCCGCGC TGG (reversed) Intergenic
911638828 1:100266130-100266152 TCGGCTTAAAGGAGCCGCGCTGG - Intergenic
917198386 1:172490565-172490587 TCGGCTTAAAGGAGTCACACTGG - Intergenic
1072525699 10:96269632-96269654 TAGGCTTAAAGGAGCCTGGTAGG - Intronic
1080842577 11:35998420-35998442 TTGGCTGAAAGGAGCCTGGCAGG - Intronic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1121342971 14:93115961-93115983 GCCTCTTAAAGGCGCCGCGCCGG + Intronic
1128554651 15:68623250-68623272 CGGGCTTAAAAGAGCCGGGCCGG - Intronic
1145243650 17:21253533-21253555 ACCTCTTAAAGGGGCCGCGCCGG + Intergenic
1150133335 17:62680782-62680804 TCGGCCTGCAGGAGCAGCGCGGG - Exonic
1166092628 19:40520051-40520073 TCGGCTTGTGGGAGGCGCGCAGG + Exonic
1166981372 19:46634235-46634257 GCGGCTCCAAGGAGCCGGGCAGG - Intronic
936265063 2:110998439-110998461 TTCACTTAAAGGAGCCGCACTGG - Intronic
1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG + Intronic
1173368110 20:42406977-42406999 TCTGCTTAAAGGAGATGAGCAGG - Intronic
1175889805 20:62311117-62311139 TGGGCTGAGAGGGGCCGCGCAGG - Intronic
1176103095 20:63373330-63373352 AAGGCTTAAAGGAGGCGCACGGG + Intronic
1184026293 22:41859440-41859462 TCGGCTGAAATGAGCCATGCAGG - Intronic
955916312 3:63912078-63912100 TCCGCTTAAGGGAGCCGGCCGGG + Intronic
994197478 5:96936126-96936148 CCGGCTGTAAGGAGCCGCGGCGG + Exonic
1016958373 6:149648632-149648654 TCGGCGAGCAGGAGCCGCGCCGG - Exonic
1016996368 6:149964673-149964695 CCGGCGGAAAGGAGCCGCGGAGG - Intronic
1016996527 6:149965352-149965374 TCGGCGGAAAGGAGCCCCGGAGG - Intronic
1057766303 9:97922430-97922452 CCGGCTTAACGCAGCCGCACGGG + Exonic
1188822099 X:34788071-34788093 TTGGCTTAAAGTAGCCTGGCTGG + Intergenic