ID: 911645027

View in Genome Browser
Species Human (GRCh38)
Location 1:100328692-100328714
Sequence AGAAAGATCAGGGTGGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911645027_911645035 30 Left 911645027 1:100328692-100328714 CCTCTATCCACCCTGATCTTTCT No data
Right 911645035 1:100328745-100328767 CACCTGATGTTTCCTGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911645027 Original CRISPR AGAAAGATCAGGGTGGATAG AGG (reversed) Intergenic
No off target data available for this crispr