ID: 911645028

View in Genome Browser
Species Human (GRCh38)
Location 1:100328699-100328721
Sequence GGAGTCAAGAAAGATCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911645028_911645035 23 Left 911645028 1:100328699-100328721 CCACCCTGATCTTTCTTGACTCC No data
Right 911645035 1:100328745-100328767 CACCTGATGTTTCCTGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911645028 Original CRISPR GGAGTCAAGAAAGATCAGGG TGG (reversed) Intergenic
No off target data available for this crispr