ID: 911645035

View in Genome Browser
Species Human (GRCh38)
Location 1:100328745-100328767
Sequence CACCTGATGTTTCCTGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911645032_911645035 1 Left 911645032 1:100328721-100328743 CCCTAAGAATGCTCACCTCACTA No data
Right 911645035 1:100328745-100328767 CACCTGATGTTTCCTGTACCTGG No data
911645028_911645035 23 Left 911645028 1:100328699-100328721 CCACCCTGATCTTTCTTGACTCC No data
Right 911645035 1:100328745-100328767 CACCTGATGTTTCCTGTACCTGG No data
911645030_911645035 19 Left 911645030 1:100328703-100328725 CCTGATCTTTCTTGACTCCCCTA No data
Right 911645035 1:100328745-100328767 CACCTGATGTTTCCTGTACCTGG No data
911645033_911645035 0 Left 911645033 1:100328722-100328744 CCTAAGAATGCTCACCTCACTAG No data
Right 911645035 1:100328745-100328767 CACCTGATGTTTCCTGTACCTGG No data
911645029_911645035 20 Left 911645029 1:100328702-100328724 CCCTGATCTTTCTTGACTCCCCT No data
Right 911645035 1:100328745-100328767 CACCTGATGTTTCCTGTACCTGG No data
911645027_911645035 30 Left 911645027 1:100328692-100328714 CCTCTATCCACCCTGATCTTTCT No data
Right 911645035 1:100328745-100328767 CACCTGATGTTTCCTGTACCTGG No data
911645031_911645035 2 Left 911645031 1:100328720-100328742 CCCCTAAGAATGCTCACCTCACT No data
Right 911645035 1:100328745-100328767 CACCTGATGTTTCCTGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911645035 Original CRISPR CACCTGATGTTTCCTGTACC TGG Intergenic
No off target data available for this crispr