ID: 911653165

View in Genome Browser
Species Human (GRCh38)
Location 1:100412491-100412513
Sequence AGGAAAATGAAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3178
Summary {0: 1, 1: 1, 2: 29, 3: 352, 4: 2795}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911653165_911653175 27 Left 911653165 1:100412491-100412513 CCTTCCTCCTTCTTCATTTTCCT 0: 1
1: 1
2: 29
3: 352
4: 2795
Right 911653175 1:100412541-100412563 CTTGTTGCTCATAGGAAGATGGG No data
911653165_911653177 29 Left 911653165 1:100412491-100412513 CCTTCCTCCTTCTTCATTTTCCT 0: 1
1: 1
2: 29
3: 352
4: 2795
Right 911653177 1:100412543-100412565 TGTTGCTCATAGGAAGATGGGGG 0: 1
1: 0
2: 0
3: 13
4: 148
911653165_911653176 28 Left 911653165 1:100412491-100412513 CCTTCCTCCTTCTTCATTTTCCT 0: 1
1: 1
2: 29
3: 352
4: 2795
Right 911653176 1:100412542-100412564 TTGTTGCTCATAGGAAGATGGGG No data
911653165_911653173 19 Left 911653165 1:100412491-100412513 CCTTCCTCCTTCTTCATTTTCCT 0: 1
1: 1
2: 29
3: 352
4: 2795
Right 911653173 1:100412533-100412555 ATTCAAGTCTTGTTGCTCATAGG No data
911653165_911653174 26 Left 911653165 1:100412491-100412513 CCTTCCTCCTTCTTCATTTTCCT 0: 1
1: 1
2: 29
3: 352
4: 2795
Right 911653174 1:100412540-100412562 TCTTGTTGCTCATAGGAAGATGG 0: 1
1: 0
2: 0
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911653165 Original CRISPR AGGAAAATGAAGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr