ID: 911657433

View in Genome Browser
Species Human (GRCh38)
Location 1:100461100-100461122
Sequence ACAGCTAGTACCTTTAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911657431_911657433 -4 Left 911657431 1:100461081-100461103 CCAGAATATGTTGGAGAAAACAG 0: 1
1: 0
2: 0
3: 13
4: 215
Right 911657433 1:100461100-100461122 ACAGCTAGTACCTTTAAGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911657433 Original CRISPR ACAGCTAGTACCTTTAAGGC TGG Intronic
902075674 1:13782930-13782952 ACAGCTATTTCCTTTAAGTGGGG - Intronic
904664036 1:32106411-32106433 ACAGCAAGCTCCTTGAAGGCAGG - Intergenic
904962874 1:34348564-34348586 ACAGCCAGTAACTTTGAGGCAGG - Intergenic
911657433 1:100461100-100461122 ACAGCTAGTACCTTTAAGGCTGG + Intronic
911976103 1:104497515-104497537 AAAGGTAGTTCCTTTAGGGCTGG - Intergenic
913086406 1:115441462-115441484 AAAGCTGGTACTTTTAAGGCAGG + Intergenic
917075682 1:171202117-171202139 GCAGCTAGTGTCATTAAGGCAGG + Intronic
917955861 1:180097351-180097373 AAAGCTAGTTACTTTAAGCCAGG - Intronic
919026282 1:192175457-192175479 TCAGCTTGATCCTTTAAGGCTGG + Intronic
921753911 1:218830276-218830298 ACATTTAGTGACTTTAAGGCAGG - Intergenic
1071747341 10:88437095-88437117 ATAGCTAGTATTTTTCAGGCAGG - Intronic
1073693886 10:105843859-105843881 ACAGCTAATATTTTTCAGGCTGG + Intergenic
1073775049 10:106775839-106775861 AAAGCAAGTTCCTTAAAGGCAGG + Intronic
1075074161 10:119339506-119339528 AGAGCTAGTACCCGAAAGGCAGG + Intronic
1075867366 10:125736505-125736527 ACAGCCAGAACTCTTAAGGCTGG - Intronic
1078884362 11:15485228-15485250 AGAGCTAATACCTTTAAGCAAGG + Intergenic
1083869880 11:65480240-65480262 ACAGCTAGTAAAAATAAGGCAGG - Intergenic
1084217276 11:67655324-67655346 AAAGTAAGAACCTTTAAGGCCGG - Intergenic
1084329365 11:68421525-68421547 ACAGCTAGTGGCTTTTAGGAAGG + Intronic
1087410325 11:97783491-97783513 CCAGCTAGCACCTTAATGGCAGG - Intergenic
1087849975 11:103016957-103016979 ACAGCAAGCACCAATAAGGCTGG + Intergenic
1087902030 11:103651661-103651683 ACAGCTAGAAAGTTGAAGGCTGG - Intergenic
1093444954 12:19246326-19246348 AAATCTAGTACATTTAAGGCTGG + Intronic
1095432178 12:42145439-42145461 ACAGTGAGTTCCTGTAAGGCAGG + Intergenic
1096073641 12:48789132-48789154 GGAGCTTGTGCCTTTAAGGCGGG - Intergenic
1099282074 12:80663352-80663374 AAAGCCAGTACCTGTAAGGGAGG - Intronic
1101068445 12:101047309-101047331 ACCGCTAGAACCTTCAAGGTTGG + Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1107802430 13:44121409-44121431 ACACTTAGTTCCTTTCAGGCTGG + Intergenic
1113221819 13:108112876-108112898 AAAGTTAGTACCTTTAACCCTGG - Intergenic
1117830293 14:59743457-59743479 ACACCAAGTATCTTTACGGCAGG + Intronic
1125820409 15:42625321-42625343 ACAGAAAATAGCTTTAAGGCTGG - Intronic
1129017959 15:72485696-72485718 ACAGCAATTACCTAGAAGGCAGG - Intronic
1131799078 15:96051361-96051383 ATAGTTAGTACCTAGAAGGCAGG + Intergenic
1140384463 16:74522338-74522360 ACAGCTAGTGCTTTCAAAGCTGG - Intronic
1141049210 16:80745440-80745462 ACAGCTAGTAAGTGTCAGGCTGG - Intronic
1144615053 17:16762336-16762358 ACAGTTAGTACAGTTAAGGGAGG + Intronic
1144872491 17:18379734-18379756 AGGGCTAGTGCCTTGAAGGCAGG - Intronic
1145724838 17:27109567-27109589 ACAGCTAGCTCCTTGAGGGCAGG - Intergenic
1146298844 17:31672459-31672481 GCAGCCATCACCTTTAAGGCTGG - Intergenic
1150913783 17:69415159-69415181 ACAGAGAGTTCCTGTAAGGCAGG + Intronic
1151371824 17:73652042-73652064 TCTGCTAGTACCTGTGAGGCAGG - Intergenic
1151748766 17:76025292-76025314 AGGGCTAGTGCCTTGAAGGCAGG + Intronic
1153816560 18:8795326-8795348 ACAGCTGATAACCTTAAGGCTGG + Intronic
1154157128 18:11952416-11952438 ACAGCAAGGACCTTAAAGGCAGG - Intergenic
1160290527 18:77589380-77589402 ACAGCAGGTCCCTGTAAGGCCGG - Intergenic
1164930904 19:32175122-32175144 TCATCTAGCACCTGTAAGGCGGG - Intergenic
933947597 2:87300151-87300173 ACAGTGAGTGCCTTGAAGGCAGG + Intergenic
936332599 2:111561426-111561448 ACAGTGAGTGCCTTGAAGGCAGG - Intergenic
939172530 2:138712201-138712223 ACAGCTAGAACCTTCATGGATGG + Intronic
942532258 2:176923712-176923734 ACAGCTACCACCTTTACTGCTGG - Intergenic
945706757 2:213244605-213244627 ACATCTACTACCCTTAAAGCAGG + Intergenic
946268271 2:218568014-218568036 AAAGGTAGTACCTGTGAGGCTGG + Intronic
1170538242 20:17362947-17362969 ACAGCTAGAACCGGGAAGGCTGG + Intronic
1177003992 21:15648269-15648291 ACAGCTACTACCTCTATGGAGGG + Intergenic
1179372047 21:40815354-40815376 ACAGATAATGCCTTAAAGGCAGG + Intronic
951547963 3:23847882-23847904 ACAGCTATTGCCTTTGGGGCTGG - Intronic
952196999 3:31086202-31086224 ACTGCTAATTCCTTTAAGACTGG - Intergenic
962119111 3:132543381-132543403 TCAGCTCTTACCTTTAAAGCTGG - Intergenic
966643449 3:182216215-182216237 TCAGGTAGTATCTTTATGGCAGG - Intergenic
969682594 4:8651682-8651704 ACAGATTGTACCATCAAGGCTGG - Intergenic
974353777 4:60785230-60785252 ACAGATAGTACCTGGAAGGCAGG - Intergenic
977332992 4:95661570-95661592 ACAGCTATTACATTTAGGCCTGG + Intergenic
981533655 4:145777052-145777074 ACAGGTATTTCCTTTAAGCCAGG - Intronic
982632382 4:157847081-157847103 GCAGCTCACACCTTTAAGGCTGG + Intergenic
992017768 5:72593465-72593487 ACAGCTAGTAATGTTGAGGCAGG + Intergenic
994354317 5:98777543-98777565 ACAGCTAGCATCATTAAGCCAGG - Intronic
995785279 5:115821099-115821121 ACAGTGAGAACCTTTAAGACAGG + Intergenic
997756805 5:136407178-136407200 ACATCTGGTTCCTTTCAGGCAGG - Intergenic
1002790516 6:434413-434435 ACAGCAAGTACCTGTAGGTCTGG + Intergenic
1005594962 6:27370143-27370165 ACTGCTAGGCCCTTTATGGCTGG - Intergenic
1006976848 6:38110426-38110448 ACAGAAAGTACCTGTAAAGCAGG + Intronic
1014583600 6:123169294-123169316 ACACCAAGTATCTTTAAGGCAGG - Intergenic
1015263166 6:131261935-131261957 AAAGATAGTAACTTTTAGGCTGG + Intronic
1018807759 6:167274386-167274408 ACATCTAGAACCCTTTAGGCAGG - Intronic
1022245711 7:28557123-28557145 ACAGCTAGTACCTTCAAACTGGG - Intronic
1032835744 7:135671701-135671723 ACAGGCAGGACATTTAAGGCCGG - Intronic
1038923632 8:32113484-32113506 GCAGCTAGCACCTGTCAGGCTGG - Intronic
1042165643 8:65943213-65943235 ACTGCTTGTAACTTTAAGACTGG + Intergenic
1043495671 8:80797518-80797540 ACAGCTTGTACCTTTCAGAGTGG + Intronic
1044703979 8:94990657-94990679 ACAGCTACTGCATTCAAGGCTGG + Intronic
1046136163 8:110030157-110030179 ACAGCGAGGAACTTAAAGGCTGG + Intergenic
1046904095 8:119553815-119553837 ACAGTGAGTTCCTTTAAGGGAGG - Intergenic
1055944365 9:81679700-81679722 ACAACTAGTACCTTTACTACAGG - Intronic
1057290351 9:93802382-93802404 ACAGCTGCCACCTTTAAGCCTGG + Intergenic
1060334384 9:122707521-122707543 ACAGCTAGTGATTGTAAGGCTGG + Intergenic
1060793238 9:126499529-126499551 ACAGCGAGTACCTTTGAAGGTGG - Intronic
1060819273 9:126652049-126652071 ACAGCCAGGACCCTTGAGGCAGG + Intronic
1061471596 9:130831168-130831190 ATAGCTAGTAGCTTTAGGGGGGG - Intronic
1185653287 X:1664881-1664903 ACAGCTATTAACATTAAAGCTGG + Intergenic
1189838814 X:45049194-45049216 ACAGCTTCTACCTTTAAGACTGG - Intronic
1196632273 X:117955568-117955590 ACAGCCAGTATTTTTAAGACAGG + Intronic
1198075691 X:133190944-133190966 TCAGCCAGCACCTTTAAGGAAGG + Intergenic
1198492990 X:137162486-137162508 ACTGGTAGTCCCTTTCAGGCAGG - Intergenic
1198641740 X:138763703-138763725 ACAGCTGGTGACTTAAAGGCGGG - Intronic